Busch Lab

ZMP

slc17a6b

Ensembl ID:
ENSDARG00000041150
ZFIN ID:
ZDB-GENE-030616-554
Description:
Vesicular glutamate transporter 2.1 [Source:UniProtKB/Swiss-Prot;Acc:Q5W8I8]
Human Orthologue:
SLC17A6
Human Description:
solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 6 [Source:HGNC
Mouse Orthologue:
Slc17a6
Mouse Description:
solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 6 Gene [Source

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa31579 Nonsense Available for shipment Available now
sa15613 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31579
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099871 Nonsense 349 515 9 11
ENSDART00000099872 Nonsense 418 584 10 12
ENSDART00000147554 Nonsense 418 428 10 10
Genomic Location (Zv9):
Chromosome 7 (position 34155472)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 32549812
GRCz11 7 32820962
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GATTGTTGGTTATTCACACAGTAAAGGAGTGGCTATTTCATTTCTAGTGT[T/A]GGCTGTCGGCTTCAGTGGATTTGCAATATCAGGCAAGCCTCTTGGGAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15613
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099871 Nonsense 512 515 11 11
ENSDART00000099872 Nonsense 581 584 12 12
ENSDART00000147554 None None 428 None 10
Genomic Location (Zv9):
Chromosome 7 (position 34150254)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 32544594
GRCz11 7 32815744
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGTATGTGCRGGACGGGGTGGAGGAAGGGGGTTATGGATACAGGCAGGGT[G/T]GAAATTATTCCTAGGTCTTGAGAAGACACAATATAYGACAAAGACACACA
Associated Phenotype:
Not determined