Busch Lab

ZMP

cryba1a

Ensembl ID:
ENSDARG00000041141
ZFIN ID:
ZDB-GENE-040718-107
Description:
crystallin, beta A1a [Source:RefSeq peptide;Acc:NP_001002410]
Human Orthologue:
CRYBA1
Human Description:
crystallin, beta A1 [Source:HGNC Symbol;Acc:2394]
Mouse Orthologue:
Cryba1
Mouse Description:
crystallin, beta A1 Gene [Source:MGI Symbol;Acc:MGI:88518]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa16878 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4612
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048720 Essential Splice Site None 196 None 6
ENSDART00000132153 Essential Splice Site None 203 None 6
ENSDART00000142041 None None 196 None 6
ENSDART00000146657 None None 196 None 6
Genomic Location (Zv9):
Chromosome 15 (position 27443156)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 28161396
GRCz11 15 28094272
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CGTTGTGTGGGACTCCTGAGCGCTTGCAGCTTTTTGTTGGGTAGGTCAGG[T/A]AAGCCTTGCTGTTTKCAGCCATGGCAGACATCTTTTAATKCRCTTTGCTG
Long Flanking Sequence:
CCATTGACTTGCATTTTCTCAATCACCAAGGAACATGATTTCAGTAAAAAACCCTCTTAAATATTCTGCTGAACTAAATCATCATGGATAAACAGCAGATTTTCTTTTTTCGGGTGTGCTAATCCTTTGTGTTGTCTTTGCAGGAATGATCTCAAGTCGAAACAGCTTGCGTTTTGTTTACACAAGCATGTGTGTTTTGTTGTACACTTTGGTCATATGTAAAAGCATGCATGGAATCAATGTGCCTGGCATCCAGTCTGGTGGCAGATGCCAGTAGGCACGATGCCTCCCTGGCTGCGGCAGATGGCATTGTGAGTAGGGTAAAGCCAAAGGCTCAGTCCAAAACAATGAGTCCTGGTCCAAAATGCTGACTCCTGCCTGCCCTGTGGCCAATCTTCCCTTTCGGTCATGCTACGTATAAATACAGCCCTTAGTTGGAGGTCTGGAGACCGTTGTGTGGGACTCCTGAGCGCTTGCAGCTTTTTGTTGGGTAGGTCAGG[T/A]AAGCCTTGCTGTTTGCAGCCATGGCAGACATCTTTTAATTCACTTTGCTGATCTGCAGAATCTATGGGTGGGGCACACTATTCTATAGAAACTATTAAAACCCAGAACAAATACGGCAAGCTTTAACGAAACAAAACTAAAGAAAAATAAGTTTAAATCAAACTTTTTAAAGTTTTAATTATAATGCAATTAAAACAAGATTAGAAATTCTGTATTTTGCACAACATAACATCTTGTTATGTGTATTTCTTAAAATAAATGTTACTGCAATCAAATGAATAAAAATAACTAAAACAAAAAAAAAAAGATAATTTCTTGTATTTATTAAAAATAAATGAAAGATTAAGTGTTTCATGTGTTGCATAACAAAACACTGCTATTATTTCAGAAAAGTAAATATGAAGCAACTGAAAGGGTTTATTATTATTATTATTATTATTGTTACTATTATTAATATTATTATATTATTATTATTACACTGTAAAGGCCAAAAGTAAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16878
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048720 Nonsense 23 196 3 6
ENSDART00000132153 Nonsense 23 203 3 6
ENSDART00000142041 Nonsense 23 196 3 6
ENSDART00000146657 Nonsense 23 196 3 6
Genomic Location (Zv9):
Chromosome 15 (position 27441526)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 28159766
GRCz11 15 28092642
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCTGTCTTTGTGGCTGTTTGTAGCTCACAGTTTATGACCAGGAGAACTTC[C/T]AAGGCAAGCGCATGGAGTTCACYGCAGCCTGTCAGAATATCATGGAGTGY
Long Flanking Sequence:
ACAAAGCATTTACTCAGACGTTTCTATTTTACTCATGCTTCTGGGATTTATTTGACATTTTATGATATTCCTGGTATATACAATTTGTAAATTTGCATATGAATTTGCCATAAAGCTGTCATTTCTGTTTCAGTAAGCTGTTGTTTTATTATTATTTTTTGTGTATCTTGTAAATCAGCAGACAGAATCAGTGAGATTTATTTACTGTGGTTGAACATCTGGCTGCCATATCTTTCTTGTTCTTCTTCCGAAGGCTATTTGAAGAGTTGTCATAATACCTGATACAGAACTCATGCGTGTTTTTATGCCAATCCTTGTGTTCTTCAGGTCTATCAGCATTGAGATATCTTGAAAGATGGCTCTGACTAATCCCATGCCACTGGGGCCATGGAAGGCAAGTAAATGCTTAAAGGCTGTGAAATGCAATGTGAGATCATATAGAGTTTAATGTCTGTCTTTGTGGCTGTTTGTAGCTCACAGTTTATGACCAGGAGAACTTC[C/T]AAGGCAAGCGCATGGAGTTCACTGCAGCCTGTCAGAATATCATGGAGTGCGGCATGGATAACGTGCGCTCTCTTAAGGTGGAGTGTGGCGCGTAAGTCATGAACAAAACTCACACAAGCATCTAAAAGGGACAATAGCAGACCTCCGCTGGCTGAATTAAAGCTGCTACTAGTCTTTAGAAGTTTGGGGACACTAGGATAAATAAAAACAACTAAATTTTCACTAAGATTGCATTTATCTCATCATTACTAATATATTTTACTTGTTTTTTGCTGTAAAATAATACATTTGTTTAGTATTGTTAGGTGTAAACAGCATTTATTTGAAACTGCTATCTTTGATGCAATTCTAAGCTTTTACTATCACTTTTGATCAGTTTAATTTATCATTTAAATCTTTCTGACCCCACACTGAAAACAGTGGCATCTATTTTATACATATTTTTGTATTTAAAAAAATTTTGACAACCATATTTATATATTTAAAAATGTGTAGATATT
Associated Phenotype:
Not determined