Busch Lab

ZMP

si:ch211-200o3.4

Ensembl ID:
ENSDARG00000041083
ZFIN ID:
ZDB-GENE-030131-4781
Description:
membrane alanine aminiopeptidase [Source:RefSeq peptide;Acc:NP_001038326]
Human Orthologue:
ANPEP
Human Description:
alanyl (membrane) aminopeptidase [Source:HGNC Symbol;Acc:500]
Mouse Orthologue:
Anpep
Mouse Description:
alanyl (membrane) aminopeptidase Gene [Source:MGI Symbol;Acc:MGI:96749]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa12011 Nonsense Available for shipment Available now
sa23292 Essential Splice Site Available for shipment Available now
sa43096 Nonsense Mutation detected in F1 DNA Not yet available
sa12973 Nonsense Available for shipment Available now
sa23291 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa12011
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060196 Nonsense 142 946 1 20
Genomic Location (Zv9):
Chromosome 18 (position 20877951)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 21108174
GRCz11 18 21097240
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGGAAGTGAGAAAATCGGATACCAATGAGAAATTGCCATTGAAGGGATAT[C/T]AAATYTTCAAGAACGAAACTAATTTCCTTGACATCCATCTTGAGGTTGCG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29029
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060196 Nonsense 183 946 1 20
Genomic Location (Zv9):
Chromosome 18 (position 20877826)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 21108049
GRCz11 18 21097115
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATTTTTACTGAATTTGAAGGGGAGCTTCTTGAGGACTTGACTGGGTTTTA[T/G]GCGAGCCGGTACACAGGGAAGGGAACTGATGACGAGGACGAAGAGAGGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23292
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060196 Essential Splice Site 295 946 3 20
Genomic Location (Zv9):
Chromosome 18 (position 20875995)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 21106218
GRCz11 18 21095284
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TACACATACATTCTCATATGTATCTAAAGGAACCCGGACAAAAATACATG[T/A]AGGTTGAGTGCCTGCTTATTTATTACAATTTTAATCATTTCACATCTAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43096
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060196 Nonsense 299 946 4 20
Genomic Location (Zv9):
Chromosome 18 (position 20875915)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 21106138
GRCz11 18 21095204
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTAATCATTTCACATCTAATCATTATTATGTGTTTCTAAGGTACATGGT[C/T]GATCAGAGGCTATTGATGCTGGCCATGCTGACTACGCACTGGAAACAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12973
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060196 Nonsense 595 946 12 20
Genomic Location (Zv9):
Chromosome 18 (position 20868603)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 21098826
GRCz11 18 21087892
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTTATGAGTAACCCAGCAACTGYTTTCTTACAGATCCAATTCCAGATTTC[A/T]AAATTGGCAAAGATAACTGGCTTCTTGCCAACWTCAACTGCACAGGCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23291
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060196 Essential Splice Site 702 946 15 20
Genomic Location (Zv9):
Chromosome 18 (position 20865449)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 21095672
GRCz11 18 21084738
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTACACACCAAAAACACCATAAAAGCTTTAACTTTACATTTCTATGTTT[A/T]GAAATACCTACGAAACTTGGTCACACCATTATATGAGGAATATGAGGAGT
Associated Phenotype:
Not determined