Busch Lab

ZMP

cxcr3.2

Ensembl ID:
ENSDARG00000041041
ZFIN ID:
ZDB-GENE-041114-186
Description:
C-X-C chemokine receptor type 5 [Source:RefSeq peptide;Acc:NP_001007315]
Human Orthologue:
CXCR5
Human Description:
chemokine (C-X-C motif) receptor 5 [Source:HGNC Symbol;Acc:1060]
Mouse Orthologue:
Cxcr5
Mouse Description:
chemochine (C-X-C motif) receptor 5 Gene [Source:MGI Symbol;Acc:MGI:103567]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa5887 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa253 Nonsense Confirmed mutation in F2 line Not yet available
sa8709 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa5887
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060137 Essential Splice Site 12 378 2 3
ENSDART00000145727 Essential Splice Site 12 219 2 3
Genomic Location (Zv9):
Chromosome 16 (position 13569805)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 11928896
GRCz11 16 11819798
KASP Assay ID:
554-3896.1 (used for ordering genotyping assays)
KASP Sequence:
TCTGAAGCTCATCATGGACAACTCAACAACAGCCRCAGAGGTCTCAGCGG[T/C]GAGTTTTAGTTGCCATTAAACTAATACTTTTAAGGGTCCCACTTTATATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa253
Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060137 Nonsense 75 378 3 3
ENSDART00000145727 Nonsense 75 219 3 3
Genomic Location (Zv9):
Chromosome 16 (position 13573797)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 11932888
GRCz11 16 11823790
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAGTGGGTAACATACTTGTGCTTTGTGTTATCCGCCGATATCGCCAATCT[C/T]GACACAGTCCCTGCTCCTTCTCACTGACAGACACCTTCCTGCTACATTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8709
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060137 Nonsense 206 378 3 3
ENSDART00000145727 Nonsense 206 219 3 3
Genomic Location (Zv9):
Chromosome 16 (position 13574190)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 11933281
GRCz11 16 11824183
KASP Assay ID:
2260-9308.1 (used for ordering genotyping assays)
KASP Sequence:
TGSAAATTCCTGGCATGAATCGAATGGTGTGCCAAATAGTTTATTCTGAA[C/T]AATACTCCAAGCAATGGCARATTGGTATGCAGCTGGTAAGCATGGTTCTT
Associated Phenotype:
Not determined