Busch Lab

ZMP

itgbl1

Ensembl ID:
ENSDARG00000040985
ZFIN ID:
ZDB-GENE-050522-410
Description:
integrin beta-like protein 1 [Source:RefSeq peptide;Acc:NP_001019243]
Human Orthologue:
ITGBL1
Human Description:
integrin, beta-like 1 (with EGF-like repeat domains) [Source:HGNC Symbol;Acc:6164]
Mouse Orthologue:
Itgbl1
Mouse Description:
integrin, beta-like 1 Gene [Source:MGI Symbol;Acc:MGI:2443439]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa41453 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa41454 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa41453
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060054 Essential Splice Site 31 406 1 8
ENSDART00000139584 None None 186 None 5
Genomic Location (Zv9):
Chromosome 9 (position 32786160)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 31942106
GRCz11 9 31752852
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTTCATCTTGCTCTCTGCCATTCGAGGAAGTTTACAGCAGTCGCTAAGG[T/G]GAGTTTAAGCTGTGTTGTTTTCTTAAACCAATTTGGCTTTTCCACTCTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41454
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060054 Essential Splice Site 148 406 3 8
ENSDART00000139584 None None 186 None 5
Genomic Location (Zv9):
Chromosome 9 (position 32815753)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 31971699
GRCz11 9 31782445
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGCAAAGACCTCTGCCGCAATGCTCAGGGTGTAGTTTGCTCCAATGCAGG[T/C]AAGATACACATCACCCAGAGACTTATAGTGTTGAGAAAGGCATACAGTAT
Associated Phenotype:
Not determined