Busch Lab

ZMP

si:dkey-49n23.1

Ensembl ID:
ENSDARG00000040920
ZFIN ID:
ZDB-GENE-050208-762
Description:
Novel protein similar to semaphorin 3 family (Sema3) [Source:UniProtKB/TrEMBL;Acc:Q1MTG9]
Human Orthologue:
SEMA3D
Human Description:
sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3D [Source:HGNC
Mouse Orthologue:
Sema3d
Mouse Description:
sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3D Gene [Source:

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa24202 Nonsense Available for shipment Available now
sa37551 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa19302
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059965 Nonsense 233 1008 7 21
ENSDART00000133335 Nonsense 178 703 6 16
ENSDART00000059965 Nonsense 233 1008 7 21
ENSDART00000133335 Nonsense 178 703 6 16
Genomic Location (Zv9):
Chromosome 22 (position 33518049)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 30879587
GRCz11 22 30828782
KASP Assay ID:
554-6168.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAACCCTCACTAATACCAGCTTCTCTTCACAGAGCCGGAGTTTGTGGGAT[C/A]ATATTCCATCCCTGACACACACAGCTTAGACGATGACAAAGTATACTTCT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4199
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059965 Nonsense 233 1008 7 21
ENSDART00000133335 Nonsense 178 703 6 16
ENSDART00000059965 Nonsense 233 1008 7 21
ENSDART00000133335 Nonsense 178 703 6 16
Genomic Location (Zv9):
Chromosome 22 (position 33518049)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 30879587
GRCz11 22 30828782
KASP Assay ID:
554-6168.1 (used for ordering genotyping assays)
KASP Sequence:
CAACCCTCACTAATACCAGCTTCTCTWCACAGAGCCGGAGTTTGTGGGAT[C/A]ATATTCCATCCCTGACACACACAGCTTAGACGATGACAAAGTATACTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24202
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059965 Nonsense 582 1008 16 21
ENSDART00000133335 Nonsense 527 703 15 16
Genomic Location (Zv9):
Chromosome 22 (position 33507054)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 30868592
GRCz11 22 30817787
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTATAGTAAGTTAAAAGTGTTCATTGCTGTCTGTAGGCTCAGAGAATGCT[G/T]AACTGAAGACGGTTTACGGCGTGGAGACAAACTCAACTTTCCTGGAATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37551
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059965 Nonsense 940 1008 19 21
ENSDART00000133335 None None 703 None 16
Genomic Location (Zv9):
Chromosome 22 (position 33447740)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 30808871
GRCz11 22 30758066
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAAACGCCTACAGCTGCGTGATTAACAACACCATCAGCAACAAGACTAAA[C/T]AGTTTAACACTGATGAACACTGTCCGATATGTAAAGGTATGTGAGGGAGT
Associated Phenotype:
Not determined