Busch Lab

ZMP

cbfb

Ensembl ID:
ENSDARG00000040917
ZFIN ID:
ZDB-GENE-980526-440
Description:
core-binding factor subunit beta [Source:RefSeq peptide;Acc:NP_954679]
Human Orthologue:
CBFB
Human Description:
core-binding factor, beta subunit [Source:HGNC Symbol;Acc:1539]
Mouse Orthologue:
Cbfb
Mouse Description:
core binding factor beta Gene [Source:MGI Symbol;Acc:MGI:99851]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa5910 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa5910
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059961 Essential Splice Site 55 187 2 6

The following transcripts of ENSDARG00000040917 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 22775919)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 23006142
GRCz11 18 22995208
KASP Assay ID:
554-3866.1 (used for ordering genotyping assays)
KASP Sequence:
AAGGCAGGCGCGCTTCCAGAACGCGTGCCGTGACGGCCGCTCAGAGATAG[T/C]GAGTACACGCACCTCACAGCACCGGACAATTACAACACTGACCCTGCGTT
Associated Phenotype:
Not determined