Busch Lab

ZMP

si:dkey-11d18.4

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa13243 Nonsense Available for shipment Available now
sa23306 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13243
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100955 Nonsense 114 311 1 2
ENSDART00000147183 Nonsense 62 253 1 1
Genomic Location (Zv9):
Chromosome 18 (position 22476698)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 22706921
GRCz11 18 22695987
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCTRACGGTTACGTCAATGAGTGTGCACCRCTATCACAATGTCATCAAGT[C/A]AAGGGTCACTAATAGGACRATTCTGCACAGACTGGAGCGACGACACAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23306
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100955 Nonsense 155 311 1 2
ENSDART00000147183 Nonsense 103 253 1 1
Genomic Location (Zv9):
Chromosome 18 (position 22476576)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 22706799
GRCz11 18 22695865
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGACTCTCGCCTTTGTTTTTGCCCTACCAGTTTATTTTACTCAAGAACTT[A/T]AAGACAAAGATGGATTCCAAAGATGTCAGAGGACAATGAGCTCAATGGCT
Associated Phenotype:
Not determined