Busch Lab

ZMP

mxi1

Ensembl ID:
ENSDARG00000040884
ZFIN ID:
ZDB-GENE-990415-151
Description:
Max-interacting protein 1 [Source:UniProtKB/Swiss-Prot;Acc:P50541]
Human Orthologue:
MXI1
Human Description:
MAX interactor 1 [Source:HGNC Symbol;Acc:7534]
Mouse Orthologue:
Mxi1
Mouse Description:
Max interacting protein 1 Gene [Source:MGI Symbol;Acc:MGI:97245]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29823
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059923 Essential Splice Site 67 222 4 6
ENSDART00000104751 Essential Splice Site 118 273 4 6
Genomic Location (Zv9):
Chromosome 22 (position 33044439)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 30405569
GRCz11 22 30354764
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGCTGCATACATGCGTGCAAAGTTGACGTTTGTCTCTTGCCATGTTTCA[G/A]GCGAGCCCACCTTCGTTTGTGTCTGGAGCGATTGAAGACGCTCATCCCGC
Long Flanking Sequence:
ATCTACATTTACACACATTTACCCAAGCAATGATGAGCTAGAAATCTGCAGATCTTTGTGTGCAGATATTCCGTGGGCCTAGAAATAAGCAGTTAATAGTGTGAATTGTTTCTTAAACTAAAGTGATACCGCACAGTCTTTTGTAAAATTTCCTTTACAGCTGTTTTAATTTCCCTTTATTTCATAATGCTGTTTTATAGTTTCACTTTTAGTTCACTAAGCTGTTGTGAGTATAGAACAAACTGCAGGTAACCTCTGTGCCAGAAAGACGAAACCCTCAAGCACTTTGATTTCCTTGAAAACAGTCTCCGAGCTCTCACTGGTATTTGTATGTAAATATGTGGGCGTGTTTGCATGGTTTGTGTTGAAGGTAGAGTATGAGGTGTTGTCTAGAAAGCTGTTGACCAAACCACACAGGCACAACAAGTTCATTGAGCATTTTGTAGGCGTCTGCTGCATACATGCGTGCAAAGTTGACGTTTGTCTCTTGCCATGTTTCA[G/A]GCGAGCCCACCTTCGTTTGTGTCTGGAGCGATTGAAGACGCTCATCCCGCTGGGACCAGAATGCAGCCGTCACACCACACTGGGGCTGCTCAACAAGGCCAAAGCACACATAAAGGTAAATGCACTGAACTGAGCTCCTGAATGAAGCAGTGCTGTGGCCTAGTGTGTTGAGCAGTGGTGCTCATATGGGAAAAATGACTTCGAATTTGGCTAACCACATTTATGCGACACGTTTACCCTCTATTATTCCATGTTATTAGTAACCTTTGCTTAGTTTATATGATTCATTATCAACAACAGCATTATTTTCAAAACAAACAAGCTTATATCTGTTAATAATAATAGTATACTAATAAATAAATTCATTCATTCGTTCATTTTTATTTGGCTTAGTCCTTTTATTCATCAGAGGTCACCACAGTGGAATGAACTGCCAACTATTTTGGAATATGTTTAAAACAGCGAATGCCCTTCCAGCTGCAACCTAGTACTGGGAAACA
Associated Phenotype:
Not determined