Busch Lab

ZMP

add3a

Ensembl ID:
ENSDARG00000040874
ZFIN ID:
ZDB-GENE-030131-2721
Description:
gamma-adducin [Source:RefSeq peptide;Acc:NP_955957]
Human Orthologue:
ADD3
Human Description:
adducin 3 (gamma) [Source:HGNC Symbol;Acc:245]
Mouse Orthologue:
Add3
Mouse Description:
adducin 3 (gamma) Gene [Source:MGI Symbol;Acc:MGI:1351615]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa37547 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa37548 Nonsense Available for shipment Available now
sa819 Nonsense Available for shipment Available now
sa11284 Nonsense Available for shipment Available now
sa11322 Nonsense Available for shipment Available now
sa19300 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4172
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027803 Nonsense 63 644 1 15
ENSDART00000040538 Nonsense 63 672 5 18
ENSDART00000049075 Nonsense 63 645 2 14
ENSDART00000140015 Nonsense 63 239 3 7
ENSDART00000141247 Nonsense 63 64 5 5
ENSDART00000142857 Nonsense 63 103 4 5

The following transcripts of ENSDARG00000040874 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 32885145)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 30246275
GRCz11 22 30195470
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGCAAGACTTCAACATGAWGGAGCAGAAGAAGAGGGTCACACAGATACTA[C/T]AGAGTCCAGTAAGGAAACACACACACATTGTGAAMTAAAGTAATGGAYAC
Long Flanking Sequence:
ATTTATATAACTTTTAGTATCTATTTGTATCAAAGTTGATACTTTTGACAACCCTGGTATTCATATACCTTGTGGTATCGATTTCTATCGAAGTCTATACTTTTGACAACCCTGATTTTTATATAGCTTTTAGTATCTATTAGTATCTAAGTCGATACTTTTGACATCCCTGGTATTTATATTGCTTTTGTATTACTGTAATTGGTTTTGTCTTGAAGATACCCTTCGATGTTGACATGACATTAAAATAAACAGTTGCCTAACTAAGCCCTGTCTTTCTCTCCAGGTGAAGACAGCAGGTGAATCCGCTAGAGATGAGTGGCGAGCCGAGACAGGAGGTGGTGACGACCCCTCCGCCACCCAGTGTGGGCAAAAGAGAGGGATACTTTGATCGCGTTAATGAAAATGACCCTGAATATCTGCGCGCACGCAACATGTCACCCGACCTGCGGCAAGACTTCAACATGATGGAGCAGAAGAAGAGGGTCACACAGATACTA[C/T]AGAGTCCAGTAAGGAAACACACACACATTGTGAACTAAAGTAATGGACACAATTGTGATTTAGACAAACTTTTTTTTTATTGCAGTTTTTAAGTAATAAAATCAAATCATGTTTTGGATCAGAAACACAGAGAGGAGGGAAATGTTGTTTGCTTTCCATTTACTACAAGAACAGTACAGCAAAGAACTTTTGGATTCAACAAAAATAACTTATAGACAAATAAAATCAAGAAATAACAAGCTAAATAAACAACATGATATATTATATATATAACATAAAATAATGTATTCAATGCCCAGTTTGTTAAAGTGAAAGGTGAAAAACAACCCTTGCTATTGTTGCTGTCTTGCTGATAATCCAAAATATAAACAAATAATTATAATCTTGCCAAGCAACAACACAATATTATATTTATTTTTTCTGATGTTCAAATAATGATTCAATAACTCATATATTATGGCTGGTTGTGGCCACTAATTGACTTGTCTATTTTTCCCCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37547
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027803 Essential Splice Site 65 644 None 15
ENSDART00000040538 Essential Splice Site 65 672 None 18
ENSDART00000049075 Essential Splice Site 65 645 None 14
ENSDART00000140015 Essential Splice Site 65 239 None 7
ENSDART00000141247 None None 64 None 5
ENSDART00000142857 Essential Splice Site 65 103 None 5

The following transcripts of ENSDARG00000040874 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 32885155)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 30246285
GRCz11 22 30195480
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAACATGATGGAGCAGAAGAAGAGGGTCACACAGATACTACAGAGTCCAG[T/C]AAGGAAACACACACACATTGTGAACTAAAGTAATGGACACAATTGTGATT
Long Flanking Sequence:
CTTTTAGTATCTATTTGTATCAAAGTTGATACTTTTGACAACCCTGGTATTCATATACCTTGTGGTATCGATTTCTATCGAAGTCTATACTTTTGACAACCCTGATTTTTATATAGCTTTTAGTATCTATTAGTATCTAAGTCGATACTTTTGACATCCCTGGTATTTATATTGCTTTTGTATTACTGTAATTGGTTTTGTCTTGAAGATACCCTTCGATGTTGACATGACATTAAAATAAACAGTTGCCTAACTAAGCCCTGTCTTTCTCTCCAGGTGAAGACAGCAGGTGAATCCGCTAGAGATGAGTGGCGAGCCGAGACAGGAGGTGGTGACGACCCCTCCGCCACCCAGTGTGGGCAAAAGAGAGGGATACTTTGATCGCGTTAATGAAAATGACCCTGAATATCTGCGCGCACGCAACATGTCACCCGACCTGCGGCAAGACTTCAACATGATGGAGCAGAAGAAGAGGGTCACACAGATACTACAGAGTCCAG[T/C]AAGGAAACACACACACATTGTGAACTAAAGTAATGGACACAATTGTGATTTAGACAAACTTTTTTTTTATTGCAGTTTTTAAGTAATAAAATCAAATCATGTTTTGGATCAGAAACACAGAGAGGAGGGAAATGTTGTTTGCTTTCCATTTACTACAAGAACAGTACAGCAAAGAACTTTTGGATTCAACAAAAATAACTTATAGACAAATAAAATCAAGAAATAACAAGCTAAATAAACAACATGATATATTATATATATAACATAAAATAATGTATTCAATGCCCAGTTTGTTAAAGTGAAAGGTGAAAAACAACCCTTGCTATTGTTGCTGTCTTGCTGATAATCCAAAATATAAACAAATAATTATAATCTTGCCAAGCAACAACACAATATTATATTTATTTTTTCTGATGTTCAAATAATGATTCAATAACTCATATATTATGGCTGGTTGTGGCCACTAATTGACTTGTCTATTTTTCCCCTTCAGTTTTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37548
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027803 Nonsense 291 644 7 15
ENSDART00000040538 Nonsense 291 672 11 18
ENSDART00000049075 Nonsense 291 645 8 14
ENSDART00000140015 None None 239 None 7
ENSDART00000141247 None None 64 None 5
ENSDART00000142857 None None 103 None 5

The following transcripts of ENSDARG00000040874 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 32930870)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 30292000
GRCz11 22 30241195
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGTGAAAGATATTTGTTTGTGTGTGTGCGTGCATTGCAGGTATTGGTTT[T/A]AAGGAATCATGGCATTGTAGCTCTCGGAGAGACCATTGAAGAGGCCTTTC
Long Flanking Sequence:
TTCTTGAATTAAGATTTTTTTGATATTTGGAGTAAGAAAAGCATTTTTTGCAGTGAATAGCTTTAGGAGAGGAGTTTCTTTCAGATATTTTAGTCTTAAAAAAACTATATTTTGACGTTTAAATGGGATAAAAGTACTTTTCCTTCCTTAAGCCAGTATAATTACTACTCCACTTTGACGTGCGCTGATCTCTTCTATCATATGTCAGGTGTCGTCTATGAAGTGCGGCCTTTTGCCCATCTCCCAGGAGGCTCTGATCCTGGGTGACATTGCCTACTACAACTACCAGGGCAGTCTGGATGAACAGGAGGAGCGTGTAGAGCTCCAGAAGGCTCTCGGCCCCACGGCGAAGGTAAACAACTCCTCTCTTGCAGCAAAAAATACCACTCTCTTGCATATATCCTTCAGATGTGGTTAAGTGTGACCACAAAAAATGCAGTTGGTATGTAAATGTGAAAGATATTTGTTTGTGTGTGTGCGTGCATTGCAGGTATTGGTTT[T/A]AAGGAATCATGGCATTGTAGCTCTCGGAGAGACCATTGAAGAGGCCTTTCACTACATTTACGGCGCTCAGTATGCCTGTGAAATTCAGGTAAAAAGTTCATGATGCTTATCAGGTTGGATACATCAACCTCATACACTCAGTACACTCATAAATATGACCTTAAGACTTGTAGATGTTAAGCCTTGTGTTTTTGTAGACATGCTTGTCCTTTTCGTTTTAATTTTTGTGATCATTTTGGCTGTGTTAAATCAAACTGCTGTTTTTTTTTACTCAAAGTATATATATTTTAGCCTCATTTCCTTTCATACGTTTTCATACATTACACTAGAGACCAAAATTGGTGAGCTTGTCACGATAAGTCATTTATGTTGTGCAATATATTGTCATTGAAACTATTGCGATAAGTGTTATTATTGTCGTTTAAAACCAGTTTATGTCTTTTTATACACTCACTGGCCACTCTATTAGGTACATGTTATTCATACAGGATTGGGCCCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa819
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027803 Nonsense 336 644 8 15
ENSDART00000040538 Nonsense 336 672 12 18
ENSDART00000049075 Nonsense 336 645 9 14
ENSDART00000140015 None None 239 None 7
ENSDART00000141247 None None 64 None 5
ENSDART00000142857 None None 103 None 5

The following transcripts of ENSDARG00000040874 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 32932974)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 30294104
GRCz11 22 30243299
KASP Assay ID:
554-0723.1 (used for ordering genotyping assays)
KASP Sequence:
CTAGGTGAATGCRTTCTCCTGTGCTGGAGGAATGGAGAACCTGATCGTGT[T/A]GGATCTGGAGAAGTTTAAAGCTCGTACRCAGGGAGTGGCACAAGTTGGAR
Long Flanking Sequence:
TTCACCTTAAAGGGTTAAACAAATAAAGCACAGCACTACTACAGTTACAGAAAAGTTTGCGCTGTTAAAATTCAATTAACTTTTAATACGTTTTGGTGCGATTATCACCCGCTATAAAAATAAAAAAACATGAATGAATGTTTTGAGTGAAAAGCTGTAATGTAGCCATGGCGGGATCAATTTTGGCATGGCACCCCTCCATGGAAGAAGTAATGTAGCGGAAACCATGCATAATAAACAGAGTAAAAGCCATAATACACTTAAAAAAACAGCCATAAAAAACTGAAACAAAGTATATAATGTTTTAAATTCTGGTACATTCCAGGAATTCAAATTGGTAGGAGAGTTGTGTAGTTCTAGTAAATTGAGTTCTGTTCAGTTTAGTATTCAGTTAAGTATAAAACTTTAAACAAAGTATAATTTGTCTAAAAATGTCCTTGTTTTTTTTTTCTAGGTGAATGCGTTCTCCTGTGCTGGAGGAATGGAGAACCTGATCGTGT[T/A]GGATCTGGAGAAGTTTAAAGCTCGTACACAGGGAGTGGCACAAGTTGGAGTCAACATGGGCTCTCAGCAGAAGTGGAGGTTGGGAGAGCTGGAGTTTGAGTCACTCATGAGGATGCTGGACAACCTGGTATGTATTGACTTAAGATCAAGTAGTCTATTCATGATCCTGACTATGAGTTCCATATCTAGTAATCTATAATGACAGACAACGGAGTAGTGAAGACATAAAACAAACAGTTACTCACATTTGTGAGGTGCAGAACTACTGTTTGATTCAATAGAGTCAGCACAACGCATTTACTTCTGAAAGTACACCATCAAACTGAGCCTTGTTTGAAAACACCTGTAAAATTAATTGGAAAAAGGACTAAGTTCTCACTGCCAGTCTTTTTGCAACATCCTGTTGTCTACATAGGTCTGCATTTGACTTTTTTTGTGTTTTAATTACTACAATGTAAATCAGTGAGCGGAACTAAACAGGCAATGATGTACAAGTAGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11284
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027803 Nonsense 380 644 9 15
ENSDART00000040538 Nonsense 380 672 13 18
ENSDART00000049075 Nonsense 380 645 10 14
ENSDART00000140015 None None 239 None 7
ENSDART00000141247 None None 64 None 5
ENSDART00000142857 None None 103 None 5
ENSDART00000027803 Nonsense 380 644 9 15
ENSDART00000040538 Nonsense 380 672 13 18
ENSDART00000049075 Nonsense 380 645 10 14
ENSDART00000140015 None None 239 None 7
ENSDART00000141247 None None 64 None 5
ENSDART00000142857 None None 103 None 5
ENSDART00000027803 Nonsense 380 644 9 15
ENSDART00000040538 Nonsense 380 672 13 18
ENSDART00000049075 Nonsense 380 645 10 14
ENSDART00000140015 None None 239 None 7
ENSDART00000141247 None None 64 None 5
ENSDART00000142857 None None 103 None 5

The following transcripts of ENSDARG00000040874 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 32938787)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 30299917
GRCz11 22 30249112
KASP Assay ID:
554-6166.1 (used for ordering genotyping assays)
KASP Sequence:
TCTTGTGTYTTATAGACGTSTGTGNTTTTTTTTCCYGTCTTCCAGGGATA[C/A]AGGACTGGCTACACATACCGGCACCCCATCGTGCGGGAGAAACCCCGACA
Long Flanking Sequence:
TTTGTATTTATAGAATTTAATACTTATTTTAACAATATAAATAGTAAGAGTAGGTGTTGTTATAGGACCTTGACCTTATTATTCACGGATGAGCAGGCGCAGACATTGGAACCTTTTTGTGTCAAGACTTCCGATCTTATTCACTTCCATTGATTTTTAGACTTTAAAAATGGCTCGTTATGCTGCTTGATGTTGCAAACTGATGCTATCCTATTATATCATTCTACTTTTTATGTGTACTCATGAACACACTTCTTTGTCACTCATTCATTGATGAGTGAACCAGAAGTTCAAAAACAAGTGCACTTCCGCATTGCAGAATTAAGTCAATAGGACAGTAGCTTGACAGGAATCAAAGTTGGAAAGAGAGAGGTGGGGGACGGATCAAGGAAATTTCATAAGCCAGGTCTTGAATGCGGGAACCAAAAGTGCAATGCTGCTATATGTTAATCTTGTGTTTTATAGACGTGTGTGTTTTTTTTTCCCGTCTTCCAGGGATA[C/A]AGGACTGGCTACACATACCGGCACCCCATCGTGCGGGAGAAACCCCGACACAAGAGCGAAGTGGAGATTCCTGCAACAGTGACGGCCTTCATGTTCGATGAGGATGACGCTCCACGCTTCCCTCTAAAGCTCCTGCAGCAGCGGCAGCAGAGAGAGAAAACACGCTGGCTCAACTCTCCAAACTGCTACATGAAGGTGAACGTGGCGGACGGCGCCAGCGAAGAGAACCGACGCACCAAGACCACGGTGAGACTGAGACTAAAATGATGTTTTCGTGAATCTAGTTTTTACAAGCCTGCATGTTACATTGGCATTGGTGATATCTTGAACCACACAGAATCTGAGACTATTATTGAGGCTGTTTATTTACATGTGTAAATATATATTTATTCAGTATTTATATTCATTTCAGTAATATTATTGAATAGTAGGTAAATGTTTATATGATTTATTTACTGTAGAGTATGTAAAGAAATATCATATATTAACTTGTTATATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11322
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027803 Nonsense 380 644 9 15
ENSDART00000040538 Nonsense 380 672 13 18
ENSDART00000049075 Nonsense 380 645 10 14
ENSDART00000140015 None None 239 None 7
ENSDART00000141247 None None 64 None 5
ENSDART00000142857 None None 103 None 5
ENSDART00000027803 Nonsense 380 644 9 15
ENSDART00000040538 Nonsense 380 672 13 18
ENSDART00000049075 Nonsense 380 645 10 14
ENSDART00000140015 None None 239 None 7
ENSDART00000141247 None None 64 None 5
ENSDART00000142857 None None 103 None 5
ENSDART00000027803 Nonsense 380 644 9 15
ENSDART00000040538 Nonsense 380 672 13 18
ENSDART00000049075 Nonsense 380 645 10 14
ENSDART00000140015 None None 239 None 7
ENSDART00000141247 None None 64 None 5
ENSDART00000142857 None None 103 None 5

The following transcripts of ENSDARG00000040874 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 32938787)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 30299917
GRCz11 22 30249112
KASP Assay ID:
554-6166.1 (used for ordering genotyping assays)
KASP Sequence:
TCTTGTGTYTTATAGACGTSTGTGNTTTTTTTTCCYGTCTTCCAGGGATA[C/A]AGGACTGGCTACACATACCGGCACCCCATCGTGCGGGAGAAACCCCGACA
Long Flanking Sequence:
TTTGTATTTATAGAATTTAATACTTATTTTAACAATATAAATAGTAAGAGTAGGTGTTGTTATAGGACCTTGACCTTATTATTCACGGATGAGCAGGCGCAGACATTGGAACCTTTTTGTGTCAAGACTTCCGATCTTATTCACTTCCATTGATTTTTAGACTTTAAAAATGGCTCGTTATGCTGCTTGATGTTGCAAACTGATGCTATCCTATTATATCATTCTACTTTTTATGTGTACTCATGAACACACTTCTTTGTCACTCATTCATTGATGAGTGAACCAGAAGTTCAAAAACAAGTGCACTTCCGCATTGCAGAATTAAGTCAATAGGACAGTAGCTTGACAGGAATCAAAGTTGGAAAGAGAGAGGTGGGGGACGGATCAAGGAAATTTCATAAGCCAGGTCTTGAATGCGGGAACCAAAAGTGCAATGCTGCTATATGTTAATCTTGTGTTTTATAGACGTGTGTGTTTTTTTTTCCCGTCTTCCAGGGATA[C/A]AGGACTGGCTACACATACCGGCACCCCATCGTGCGGGAGAAACCCCGACACAAGAGCGAAGTGGAGATTCCTGCAACAGTGACGGCCTTCATGTTCGATGAGGATGACGCTCCACGCTTCCCTCTAAAGCTCCTGCAGCAGCGGCAGCAGAGAGAGAAAACACGCTGGCTCAACTCTCCAAACTGCTACATGAAGGTGAACGTGGCGGACGGCGCCAGCGAAGAGAACCGACGCACCAAGACCACGGTGAGACTGAGACTAAAATGATGTTTTCGTGAATCTAGTTTTTACAAGCCTGCATGTTACATTGGCATTGGTGATATCTTGAACCACACAGAATCTGAGACTATTATTGAGGCTGTTTATTTACATGTGTAAATATATATTTATTCAGTATTTATATTCATTTCAGTAATATTATTGAATAGTAGGTAAATGTTTATATGATTTATTTACTGTAGAGTATGTAAAGAAATATCATATATTAACTTGTTATATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19300
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027803 Nonsense 380 644 9 15
ENSDART00000040538 Nonsense 380 672 13 18
ENSDART00000049075 Nonsense 380 645 10 14
ENSDART00000140015 None None 239 None 7
ENSDART00000141247 None None 64 None 5
ENSDART00000142857 None None 103 None 5
ENSDART00000027803 Nonsense 380 644 9 15
ENSDART00000040538 Nonsense 380 672 13 18
ENSDART00000049075 Nonsense 380 645 10 14
ENSDART00000140015 None None 239 None 7
ENSDART00000141247 None None 64 None 5
ENSDART00000142857 None None 103 None 5
ENSDART00000027803 Nonsense 380 644 9 15
ENSDART00000040538 Nonsense 380 672 13 18
ENSDART00000049075 Nonsense 380 645 10 14
ENSDART00000140015 None None 239 None 7
ENSDART00000141247 None None 64 None 5
ENSDART00000142857 None None 103 None 5

The following transcripts of ENSDARG00000040874 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 32938787)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 30299917
GRCz11 22 30249112
KASP Assay ID:
554-6166.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTTGTGTTTTATAGACGTGTGTGTTTTTTTTTCCCGTCTTCCAGGGATA[C/A]AGGACTGGCTACACATACCGGCACCCCATCGTGCGGGAGAAACCCCGACA
Long Flanking Sequence:
TTTGTATTTATAGAATTTAATACTTATTTTAACAATATAAATAGTAAGAGTAGGTGTTGTTATAGGACCTTGACCTTATTATTCACGGATGAGCAGGCGCAGACATTGGAACCTTTTTGTGTCAAGACTTCCGATCTTATTCACTTCCATTGATTTTTAGACTTTAAAAATGGCTCGTTATGCTGCTTGATGTTGCAAACTGATGCTATCCTATTATATCATTCTACTTTTTATGTGTACTCATGAACACACTTCTTTGTCACTCATTCATTGATGAGTGAACCAGAAGTTCAAAAACAAGTGCACTTCCGCATTGCAGAATTAAGTCAATAGGACAGTAGCTTGACAGGAATCAAAGTTGGAAAGAGAGAGGTGGGGGACGGATCAAGGAAATTTCATAAGCCAGGTCTTGAATGCGGGAACCAAAAGTGCAATGCTGCTATATGTTAATCTTGTGTTTTATAGACGTGTGTGTTTTTTTTTCCCGTCTTCCAGGGATA[C/A]AGGACTGGCTACACATACCGGCACCCCATCGTGCGGGAGAAACCCCGACACAAGAGCGAAGTGGAGATTCCTGCAACAGTGACGGCCTTCATGTTCGATGAGGATGACGCTCCACGCTTCCCTCTAAAGCTCCTGCAGCAGCGGCAGCAGAGAGAGAAAACACGCTGGCTCAACTCTCCAAACTGCTACATGAAGGTGAACGTGGCGGACGGCGCCAGCGAAGAGAACCGACGCACCAAGACCACGGTGAGACTGAGACTAAAATGATGTTTTCGTGAATCTAGTTTTTACAAGCCTGCATGTTACATTGGCATTGGTGATATCTTGAACCACACAGAATCTGAGACTATTATTGAGGCTGTTTATTTACATGTGTAAATATATATTTATTCAGTATTTATATTCATTTCAGTAATATTATTGAATAGTAGGTAAATGTTTATATGATTTATTTACTGTAGAGTATGTAAAGAAATATCATATATTAACTTGTTATATGA
Associated Phenotype:
Not determined