Busch Lab

ZMP

gas8

Ensembl ID:
ENSDARG00000040871
ZFIN IDs:
ZDB-GENE-030131-1980, ZDB-GENE-030131-1980
Description:
growth arrest-specific protein 8 [Source:RefSeq peptide;Acc:NP_955928]
Human Orthologue:
GAS8
Human Description:
growth arrest-specific 8 [Source:HGNC Symbol;Acc:4166]
Mouse Orthologue:
Gas8
Mouse Description:
growth arrest specific 8 Gene [Source:MGI Symbol;Acc:MGI:1202386]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa17198 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa6195
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059907 Essential Splice Site 182 475 5 11
ENSDART00000122873 Essential Splice Site 182 475 5 11
Genomic Location (Zv9):
Chromosome 11 (position 11212074)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 31068444
GRCz11 18 31046698
KASP Assay ID:
554-5044.1 (used for ordering genotyping assays)
KASP Sequence:
TGATGAGGAAACTACTGATTTGAGAAATGATTTTGCCAGACAAGTACAAG[G/A]TAAAGTTGCTGTCTAATAAATTATTTTGACACACTTAAGTACAAGTGCAT
Long Flanking Sequence:
TCTGCTGTTGTTGAGAGCAGTTGCAATAGATTTCCAACGTTATACGCCTAGTCATCAATAAAGCCTATTAAAAAAATTTGCACATGTGCGACTAAATAAATTATCCAGTTCGCACACATCTATTTTCAGATCGCAAATGCGAGTGAAATGGTCACACTGTCGAGCCCTGTAAGTAGTTTATTTAAACATTTGTCTAATTAAGGATGTCATTTATTTAATTGACAAATTAATTTAATTGACAGTATTCTTGTAATAAATTACATTTGCCATTTTGAGAAATGTTAATTATTATAATATTTATGTATTTCTGAAAATTGATCTGATCCATGTCACAAACATTGGAAAGTTGTATTTTTGTAATTCACACCATGATTACTGATTACAGTGGCAATTACACTTCTTTTTTGCATTTTACGTTTAGCTAAACAAAATTGTCTTTCAACAGAAACATGATGAGGAAACTACTGATTTGAGAAATGATTTTGCCAGACAAGTACAAG[G/A]TAAAGTTGCTGTCTAATAAATTATTTTGACACACTTAAGTACAAGTGCATCACAATTAGAATATCATTAAAAAGTTTATTTCAGTCATTCAATTCAAAAAGTGAAATGTATATATTATATTGATTCATTACACTAAGACTAATATAATTAAAGTGTTTATTTTTTTTTTTTTAACTATTAATGTTTGCCTTCTAGCTAATGAAAACCTAATAATCAGTTTCCCAGAAAATTAGAATACTAATTAGGACCAAAAAAAAAAAAGGATTTTTAACACAGAAATTTTGGACTACCGAAAAGTATAAACATGTACAGCATTCAATACTTGGTCAAAGACGAAACATCAATATCCATCATGCTAAATATTCCAGACCAGTTGGCCAACTGATCAAATGTAGTGACAAGCTGCAGCAAATTAGAGAGCCATGAGCTGAATGGCTGTTGTGTTCAGCAGCTCAACGGACATGTCTGTGATTGACTGAAATAGTTATCGATGTACTCGC
Associated Phenotype:
This allele has been associated with this phenotype by genetic linkage analysis and may not be causal.
See FAQs for more info.
Stage Entity Quality Tag
Larval:Protruding-mouth
ZFS:0000035
larval locomotory behavior
GO:0008345
disrupted
PATO:0001507
abnormal
PATO:0000460
Larval:Protruding-mouth
ZFS:0000035
otolith
ZFA:0001617
quality
PATO:0000001
normal
PATO:0000461
Larval:Protruding-mouth
ZFS:0000035
trunk
ZFA:0001115
curved ventral
PATO:0001469
abnormal
PATO:0000460

Mutation Details

Allele Name:
sa17198
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059907 Nonsense 230 475 6 11
ENSDART00000122873 Nonsense 230 475 6 11
Genomic Location (Zv9):
Chromosome 11 (position 11217112)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 31063406
GRCz11 18 31041660
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGAAGAACACCCACATTAACATGCTGATGAAGAACCATGAAAAAGCTTTC[A/T]GAGACATCAGAAACTACTTYAGTGACATAGTCTACAAGAATCTGGACCTT
Long Flanking Sequence:
AAACGTAAACCTTTTATGGGTGGTTGGATTTATTTAATGCATGTTAAAATACTTGTGAATTTTATTTACATCATTATGACAAAATCTATGTGATTATTTAACAGAGATTGACAGTTAAATCAGGCCCCTCCTATCGAATTATTAAATATTCGACCATTTTGGGTCACCCCTTTGATAATTATTATTTTGCTGTTCTTTTAATTCATTATCTCATTATTGATTTTGAAGCACTTGTGTATTGATGAGTAGCAAATATTTTTTACATAATTTTCTGTAAAAATACAGTGTAGCATAAAACAAAAGGAATGAGAAATGAAGACTTTGTGCAATAATCTAACTTGAGTCAAAATACTGTCACAGAAATTGGGTCCAAATATGAGAAAAGGATGCAGAAACTGCGTCAGGAGGAAGAACTGAGACGCAAGACAGAGATTCATGAGATTGAGGAGCGGAAGAACACCCACATTAACATGCTGATGAAGAACCATGAAAAAGCTTTC[A/T]GAGACATCAGAAACTACTTCAGTGACATAGTCTACAAGAATCTGGACCTTATCACTTCACTCAAGGTAAAAGAACACAATGATGGTTTTATTTATATTGCAGGTTCATGCAGTTTGCTTGTAGCTGTCAATGCTTAGTTTTCATACAAAGACATTTGACAGAATGAATTTAGGGATTGGCAATGTTGTTTACCTTTATATGGTATTTCCAGTATTTTGGTTAGAAGGTCTTGAATAACTGAATAACTGTGTATAAATTATTTGTTTGCCATGGTATATGTGATCTGCAATTTCTCTGCAATTTAGCTAGCAGAAGTTTTAATTACAAATTATAAGAATAAGTAAACATTCTTTCTTGTCAGAATGTACTGAGCTCAGTATGTCTGATTTTCACAGTATGTCTGATAATATTATTTCTTCTGGAGAAATATATTTGTTTTATTTTGGCTAGAATAAAAGCATTTTTTTATTTTTTTAAAAATTATTCACCCCTTTAAGCTA
Associated Phenotype:
Not determined