Busch Lab

ZMP

si:dkey-27n14.1

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa16966 Nonsense Available for shipment Available now
sa6418 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa16966
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059828 Nonsense 30 386 1 1
ENSDART00000135872 None 2 319 1 2
Genomic Location (Zv9):
Chromosome 16 (position 18820381)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 16850704
GRCz11 16 16758681
KASP Assay ID:
2260-9455.1 (used for ordering genotyping assays)
KASP Sequence:
TTCACCTTCATACACCTTTCCTTTTTTCACTAACCTTTCCTTTCCCTCAT[C/A]ATCACCCTCTCTCTCCCCATCCCCAAGTGTAGCTTCCACTGCTCTCTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6418
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059828 Nonsense 345 386 1 1
ENSDART00000135872 Nonsense 280 319 2 2
Genomic Location (Zv9):
Chromosome 16 (position 18819436)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 16849759
GRCz11 16 16757736
KASP Assay ID:
554-4943.1 (used for ordering genotyping assays)
KASP Sequence:
TGTGGTGCCGGTTGGGACACAGGTGACCATWAATCGCATCCTCACAGGAT[T/A]GACTTATGGAAACTCATGTGTGAATCCGTTCTTCTACACACTCCTRACAG
Associated Phenotype:
Not determined