Busch Lab

ZMP

lactb

Ensembl ID:
ENSDARG00000040803
ZFIN ID:
ZDB-GENE-020111-1
Description:
serine beta-lactamase-like protein LACTB, mitochondrial [Source:RefSeq peptide;Acc:NP_001018429]
Human Orthologue:
LACTB
Human Description:
lactamase, beta [Source:HGNC Symbol;Acc:16468]
Mouse Orthologue:
Lactb
Mouse Description:
lactamase, beta Gene [Source:MGI Symbol;Acc:MGI:1933395]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4309
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059800 Nonsense 375 536 6 6
Genomic Location (Zv9):
Chromosome 25 (position 33875624)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 32780363
GRCz11 25 33265790
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CGCAGATTCTACCACTTCAACAAAAAGGGCCGTGTTGTGAACTGCCCGTA[T/A]GTGGACAACTCCTACAAATGGGCYGGCGGAGGTTTCCTGTCAACCGCAGG
Associated Phenotype:
Not determined