Busch Lab

ZMP

LOC100001636

Ensembl ID:
ENSDARG00000040765
Human Orthologues:
DRD1, DRD5
Human Descriptions:
dopamine receptor D1 [Source:HGNC Symbol;Acc:3020]
dopamine receptor D5 [Source:HGNC Symbol;Acc:3026]
Mouse Orthologues:
Drd1a, Drd5
Mouse Descriptions:
dopamine receptor D1A Gene [Source:MGI Symbol;Acc:MGI:99578]
dopamine receptor D5 Gene [Source:MGI Symbol;Acc:MGI:94927]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa41957 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa41957
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059735 Nonsense 194 409 1 1
Genomic Location (Zv9):
Chromosome 12 (position 6327224)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 5424101
GRCz11 12 5459058
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCCTCGCTCATAAGCTTTTACATCCCTGTTATAATCATGATAGGAACATA[T/G]ACGCGGATCTACCGGATCGCGCAAACGCAGATTAGGAGGATCTCCATTTT
Long Flanking Sequence:
GGCAACACGCTCGTGTGCGCCGCCGTCATCAAATTCAGACATCTCCGATCCAAAGTCACCAATTTTTTCGTCATATCCCTAGCAGTATCTGATCTGTTCGTGGCTGTCCTGGTCATGCCGTGGAAGGCTGTCTCCGAGGTGGCCGGCTGCTGGCTCTTCGGCGGCTTCTGTGACACTTGGATAGCTTTTGACATCATGTGTTCAACGGCGTCAATCCTCAACCTGTGCATCATCAGTTTGGACAGATACTGGGCCATCTCAAGCCCCTTTCGCTACGAGCGTAAAATGACCCAGAGGATGGCCTTTATAATGATCGGCATGGCGTGGACACTTTCCGTCCTGATCTCTTTCATTCCGGTCAAACTTAACTGGCACAGAGCTGTGGATCACAACCTCACCGTCCCATCCGAGGACTGCACCGCCTCTTTAAACAGGACGTATGCCATCGCGTCCTCGCTCATAAGCTTTTACATCCCTGTTATAATCATGATAGGAACATA[T/G]ACGCGGATCTACCGGATCGCGCAAACGCAGATTAGGAGGATCTCCATTTTGGAGCGCGCGGCCGGACACGCGCAGAGCCAGCAGGACTGCGCGAGCGAGCAGTCGCTGAAGAGCACGTTTAAGAAAGAAACGAAGGTGTTGAAAACGCTTTCCATCATCATGGGTGTGTTTGTGTTTTGCTGGCTGCCCTTTTTCGTCCTCAACTGCATCGTGCCGTTCTGCGACACTCTTGGAGACTCTCCGTGCGTGAGCAGCACCACCTTCAACATCTTCGTGTGGTTCGGATGGGCCAATTCATCGCTCAACCCGGTGATCTACGCGTTCAACGCGGATTTCCGCAAAGCCTTCAGTACTATTCTCGGCTGCAACCGACTCTGCGCGTCTTCCACGGTGGAGACGGTGAACTTCACCAACGAGCTCGTGTCCTACCATCACGACACCACTCTGATGCACAAGGACGCGCAGGGAGTTTCCAGTCCGCGCCTGGATTTGGTCCCGGG
Associated Phenotype:
Not determined