Busch Lab

ZMP

si:dkeyp-94h10.1

Ensembl ID:
ENSDARG00000040741
ZFIN ID:
ZDB-GENE-070912-690
Description:
LOC555922 protein [Source:UniProtKB/TrEMBL;Acc:A4QN54]
Human Orthologue:
KCNAB1
Human Description:
potassium voltage-gated channel, shaker-related subfamily, beta member 1 [Source:HGNC Symbol;Acc:622
Mouse Orthologue:
Kcnab1
Mouse Description:
potassium voltage-gated channel, shaker-related subfamily, beta member 1 Gene [Source:MGI Symbol;Acc

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2086
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112711 Essential Splice Site 96 369 4 14
ENSDART00000133698 Essential Splice Site 40 268 2 11
Genomic Location (Zv9):
Chromosome 2 (position 44531620)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 44617121
GRCz11 2 44470119
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GAAAATGGGGTGAATCTCTTTGACACTGCAGAGGTCTACTCAGCTGGCAA[G/A]TGAGTTTGGCCNTTAATTAATAGCAACAATAATGATCTTTTGTGTTTTCT
Associated Phenotype:
Not determined