Busch Lab

ZMP

ctdsp1

Ensembl ID:
ENSDARG00000040674
ZFIN ID:
ZDB-GENE-050522-523
Description:
carboxy-terminal domain RNA polymerase II polypeptide A small phosphatase 1 [Source:RefSeq peptide;
Human Orthologue:
CTDSP1
Human Description:
CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 1 [Source:HGNC Sym
Mouse Orthologue:
Ctdsp1
Mouse Description:
CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 1 Gene [Source:MGI

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa18259 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5558
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100226 Nonsense 86 265 3 7
Genomic Location (Zv9):
Chromosome 9 (position 42794345)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 41919515
GRCz11 9 41721302
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCAATGTCCTTGAACTTTTATTACAGGTCCCAGCCAAACCACTTCTTCCA[C/T]AGATAAAGTCTAAAGATGTAGGGAAGATCTGCGTAGTAATTGATCTGGAT
Long Flanking Sequence:
TACTAATAAACTAATACCATCCAATTTTGGCATCATAGTTAGCTCAACTAGTTTTAGTGCAGTTGTTGCTTGCTTTTTCTCAATTTCTGGAGACGTCATATATATTTACAGTTTTCCATGTGACTTTACCGCTCTCACACGTGAAGAACTTGAAACCGCTCTGTCCACTGATAGCTCCTCATATAAACATATAGAATATCAAATAAAATCTTTGCCGGTTGACACATTTTACTGTCTGCAATACAGTACATGCCTTCATAGCAACCAGCTGTACACGTATTACTTATAAAACTAGATTTCTTGTCTACTAGCACATTAGAGGAGACTCATGGAGTCTTAGTATTTCTTATGTGCAAGTTGTATGTTCTTATAGGTAATGTATATAATGTGTACTGTGTTTTAAATGTAAAACAACTTCTTGTTTCAAATGCCACCTTGGTTAATTATTTACCAATGTCCTTGAACTTTTATTACAGGTCCCAGCCAAACCACTTCTTCCA[C/T]AGATAAAGTCTAAAGATGTAGGGAAGATCTGCGTAGTAATTGATCTGGATGAAACACTAGTCCACAGTTCATTCAAGGTAGGCCAATGTGTTGAGTTATTTTTTTTTTTCTTATTGGTTTATAGCTGGTAGCAGGTGTGAGTTTATATCATGCTGTTGGCAACCTAACTAACCTTATCATAGCCATGGATACACTTGAGTCAAACATTATACTGGCGTTAAGCAACATTGCTTGTGTTTACATCAAAACTTTAAAACTTAATTCATTATTTGATGCTAAAATGTTTTATCTTGTCCAGGCTCAAAGGTTTAGCTTACTTAAATATATAAATAAGGTGAAATTTGACTCATCTTGTGAACTTTTCTTTTCATTTCTAAGCATTTCTTTTGTAAATTATTTTGTGAATATTTCAGTTTTGTTTTTTTTATTTTTACTACATAATTATATTCACTATGGTCCCCTTTTGTTTTTAACTTTCATTGATAAAAATGTTTTAAAAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3740
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100226 Essential Splice Site 223 265 6 7
Genomic Location (Zv9):
Chromosome 9 (position 42809768)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 41934938
GRCz11 9 41736725
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CATTGTGGACAACTCGCCAGCCTCCTACATATTCCACCCAGACAATGCTG[T/A]ACGTTACTGCCTTTCTTTGTTCTGTGGCACTAATGCGCTTATTACTGCTA
Long Flanking Sequence:
TAATTAGGTTAACTAGGCAGGTTAAGGTAGTTAGGCAAGTTCTTGTATAATGATGGTTTGTTCTGTAGATTATCAAAAAATATATATCTTAAAGAGGCTAATCATTTTGACCTTAAAATGGTTTTTAAAAAAATAAAAACTGCTTTTATTCTAGCCGAAATAAAACAGATAAGACTTTTTATATTCATTCTGATGTGGACACTAAAATGGGATTTCACATCTTTAACTTAACATCTTTGTTGATGCTTGACACTTTGCTTCCATTTCAGTCTAACTGTGTCTTTCACTTTCCTGTGGTTTTGTTATTTTCTAGTATGCTGATCCCGTCTCGGATCTGCTGGACAAATGGGGAGCTTTCCGAAGCCGTCTTTTCCGGGAATCCTGTGTGTTCCATCGCGGAAATTATGTGAAGGACCTAAGCCGTCTAGGCAGGGATCTCAACAAAGTCATCATTGTGGACAACTCGCCAGCCTCCTACATATTCCACCCAGACAATGCTG[T/A]ACGTTACTGCCTTTCTTTGTTCTGTGGCACTAATGCGCTTATTACTGCTAAAAGAGTTTTACTAAACCTCATGAGAATGTATTTATCAGAGCATATGTCATATTGTAAAATTGAAAAAGAAAAAAAAAAAAGATATGGGTGGCAAACTCGGTTACTGGAGGGGCGCAGCTCTGCACAGTTTAATTCCAAACCTAATTAAACACACATGATCAAACTGATTGAGTGCTTTAGGCTTGTTTGCTACCTACAGGTGTGTTGAAGCAGGGCTGGAACTAAACTCTGCAGGGCTGCGGCCCTTTACGAGTTTGACACCCTTTCTATAAGAGTTAATTCTATACTTTTAAGTCAGCAGAGAAATCAACACAATCTCACTGCAATTGAAACCTTTTGATTTACTGTAATTTTTGTATGATTTAATTAGTACATTTTAGTGCAATGGTTGCCAAACTGGGATGCATGCATCCATATGGGTGCGCAATCTGACTACCAGGTGTGCACGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18259
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100226 Nonsense 255 265 7 7
Genomic Location (Zv9):
Chromosome 9 (position 42812606)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 41937776
GRCz11 9 41739563
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTGGATCTCATCCCGTTTTTCGAGAGACYGAGTAAAGTGGATAACGTCTA[C/A]ACTGTRCTCAAGCAGCAGAGGACTACTAGTTAGCATGACWCTAAAAGCAG
Long Flanking Sequence:
TTATTATGGGTGTATTTTGACTATTTTAAAACCAAAGCTGTTAAATTATTGCAAATGTTTTTTTTTTTTTGTTTTTTTTTATTGAAACTTTGGTAACTCTTTAAAATAATGATGTATTATTTAATGTATTTACTAACATGAATAAGCAATTAATAATACATTTCTTACAATATTTATGTATCTTCATTCATTTTAGTTTGTGGAAATAAAATTGTTCATGATAATATTAATGTATTTGGATAAATATTTTAATAATGCATCAGTAAATGTTGAACTATGATTATTATTAAATGCTGTACAAGTATTGTTCATTGTCACTTCATGTTAATAAATTCTTTAATTAGCAATATATTCACTTTATATCCCAGTATTTCTGAACACAAACTCTTCTTCTGTCGCGTTTAGGTACCTGTAGCCTCCTGGTTTGACGACATGTCTGACACAGAGCTGCTGGATCTCATCCCGTTTTTCGAGAGACTGAGTAAAGTGGATAACGTCTA[C/A]ACTGTGCTCAAGCAGCAGAGGACTACTAGTTAGCATGACACTAAAAGCAGCTGTCACTTTGGGGCCAGGGAGGCTGCGGGGCCCGGAGCGCCACACTGCTTCCCCCTAACAGGACCAGCCACTAGCTCAGTCCTCATCACCTACCCACAATTCCATTCACATGATTGTTTGATAGAAAGAGAGAGAGAGTAAAGACAGAACTGTGAAGGACTGCTTTATCCATTACATGCATAAAACAGTGAATCAAGAAGCTGATTGTTTTGACACTCGATTGGGTGAACTTTTTAGGAAAGCTGCCGAAAAGTTTTCACAAAGGAAATCGTATTTTGTTTAAAGAAAACGCAGCAGCCAAGCACATTTCCCCCCGATTTTTGTATTAATGCAGGAAATGCAAACTTATATATTACTGTAATGTGTAAAAAAAAACATGATAATATATTAAAATTGTATTGTATTTATACATTATGGTTGTATTTGTTGTACTGCCTTTAATTTATTTG
Associated Phenotype:
Not determined