Busch Lab

ZMP

prickle1a

Ensembl ID:
ENSDARG00000040649
ZFIN IDs:
ZDB-GENE-030724-5, ZDB-GENE-030724-5
Description:
prickle-like 1 (Drosophila) a [Source:RefSeq peptide;Acc:NP_899185]
Human Orthologue:
PRICKLE1
Human Description:
prickle homolog 1 (Drosophila) [Source:HGNC Symbol;Acc:17019]
Mouse Orthologue:
Prickle1
Mouse Description:
prickle homolog 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1916034]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa24579 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24579
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059514 Nonsense 596 793 8 8
ENSDART00000101851 Nonsense 596 793 7 7
Genomic Location (Zv9):
Chromosome 25 (position 386210)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 294848
GRCz11 25 317755
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGATGAAGAGCCTGACGTCTGATCTGGACCGAACTCAAGTGATAGAGGAA[C/T]AGCAGGAGCAGGGCGTACCGAGCCCTGAGGTACACCCCAAACCACCGCGC
Associated Phenotype:
Not determined