Busch Lab

ZMP

sestd1

Ensembl ID:
ENSDARG00000040614
ZFIN ID:
ZDB-GENE-030801-1
Description:
SEC14 domain and spectrin repeat-containing protein 1 [Source:UniProtKB/Swiss-Prot;Acc:Q7SX85]
Human Orthologue:
SESTD1
Human Description:
SEC14 and spectrin domains 1 [Source:HGNC Symbol;Acc:18379]
Mouse Orthologue:
Sestd1
Mouse Description:
SEC14 and spectrin domains 1 Gene [Source:MGI Symbol;Acc:MGI:1916262]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa30926 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa27473 Nonsense Mutation detected in F1 DNA Not yet available
sa41542 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa12958 Essential Splice Site Available for shipment Available now
sa11814 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa30926
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059448 None None 714 None 19
ENSDART00000059453 None None 489 None 21
ENSDART00000130505 None None 703 None 18
ENSDART00000133589 None None 233 None 9
ENSDART00000139775 Essential Splice Site None 714 1 19

The following transcripts of ENSDARG00000040614 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 44286163)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 43411333
GRCz11 9 43213120
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GACGATTATCAATAACATAGATCGACTCCGGAGCTCAATGCGGAGAAAGG[T/C]AACCTCATTTCTTACTCATAATCTATCAGTGTGACTGAAATTGCTGTGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27473
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059448 Nonsense 27 714 4 19
ENSDART00000059453 None None 489 4 21
ENSDART00000130505 Nonsense 27 703 2 18
ENSDART00000133589 Nonsense 27 233 3 9
ENSDART00000139775 Nonsense 27 714 4 19

The following transcripts of ENSDARG00000040614 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 44270121)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 43395291
GRCz11 9 43197078
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGACTCTGCCTGTTTGGTTTTCCAGGAGGCAAGGACAGGCGCAGTGGTT[T/A]AATCCTGACCATCCCACTATGCACCGAACAGACCAGCATGGAGGAGCTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41542
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059448 Essential Splice Site 193 714 8 19
ENSDART00000059453 Essential Splice Site None 489 8 21
ENSDART00000130505 Essential Splice Site 193 703 6 18
ENSDART00000133589 Essential Splice Site 193 233 7 9
ENSDART00000139775 Essential Splice Site 193 714 8 19

The following transcripts of ENSDARG00000040614 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 44248829)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 43373999
GRCz11 9 43175786
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTTATCGTCATCAATGAAAACGAGAAGGGAAGCCAGGCAGAGAAGGACAG[G/A]TATTTTATGTCTCATTATCTCCAGACAAGAGCTCTTAATTAGCACTGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12958
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059448 Essential Splice Site 511 714 15 19
ENSDART00000059453 Essential Splice Site 159 489 15 21
ENSDART00000130505 Essential Splice Site 511 703 13 18
ENSDART00000133589 None None 233 None 9
ENSDART00000139775 Essential Splice Site 511 714 15 19

The following transcripts of ENSDARG00000040614 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 44229168)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 43354338
GRCz11 9 43156125
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGATGCTGCAGATGGTTCAGCTCTTCAAGTGTGAGGAAGATGCTTCACAG[G/A]TCAGACAATGACATTCATGTGGACTAGGGCTGCACTATATYGGGAAAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11814
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059448 None None 714 None 19
ENSDART00000059453 Nonsense 427 489 20 21
ENSDART00000130505 None None 703 None 18
ENSDART00000133589 None None 233 None 9
ENSDART00000139775 None None 714 None 19

The following transcripts of ENSDARG00000040614 do not overlap with this mutation:

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 44191292)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 43316462
GRCz11 9 43118249
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGCCTCATGATGAGTAGACAGGCTCATCTGCAAGAGAGCAATRCTTTTTA[C/A]AGCAGCGCTAATAAAGTACGTAATCAAGYAGCACTTCACATACTTTGACT
Associated Phenotype:
Not determined