Busch Lab

ZMP

hnrnpul1

Ensembl ID:
ENSDARG00000040564
ZFIN ID:
ZDB-GENE-040426-2432
Description:
heterogeneous nuclear ribonucleoprotein U-like protein 1 [Source:RefSeq peptide;Acc:NP_998436]
Human Orthologue:
HNRNPUL1
Human Description:
heterogeneous nuclear ribonucleoprotein U-like 1 [Source:HGNC Symbol;Acc:17011]
Mouse Orthologue:
Hnrnpul1
Mouse Description:
heterogeneous nuclear ribonucleoprotein U-like 1 Gene [Source:MGI Symbol;Acc:MGI:2443517]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa23344 Nonsense Available for shipment Available now
sa36693 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa705 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4762
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059360 Essential Splice Site 286 784 7 16
Genomic Location (Zv9):
Chromosome 18 (position 34167154)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 35846310
GRCz11 18 35827318
KASP Assay ID:
2261-2425.1 (used for ordering genotyping assays)
KASP Sequence:
CATGTTGTGAGAGTGGGCTGGTCTCTGGATTCCTGCAGCACACAGCTTGG[T/C]AAAACAAACACATACAATCATAGTCAATGGCAATTTATCAAATGAATGGT
Long Flanking Sequence:
TTGATACTTGTATGTGAACACATGTTTGGTCTAATTAGGATTTGGAATAACTTTGAAATAAACTTGTCATTTTCTTTACTCACCTTAACAGATAACAGTGATTTGCACTTCAAAGTCTCTCCTGACCACTGCAGCGGCTATCCTTTAACCATTGAAGGGTTTGCTTACCTCTGGTCTGGAGCACGTGCTACATATGGAGTAAACAAGGGACGTGTTTGCTATGAGTTAAAGGTAATATCCAATAGAGAATAAAGTTAATTAAAAAAAGAAAATAATAATTCTAATTAAAAATCTAGTCTCACAATGTGTTTAGATTCATTTCCTTTTGGTCAATATTGCACATCCAAAGTCATTACAACATTATCAACATGATTAGTATCATGGCACTTTATTTTTCAGGTAAAGGAGTATATATCAGTAAAACATCTTCCCAGCAGTGAGCCTGACCCTCATGTTGTGAGAGTGGGCTGGTCTCTGGATTCCTGCAGCACACAGCTTGG[T/C]AAAACAAACACATACAATCATAGTCAATGGCAATTTATCAAATGAATGGTCTTTCTTGATTCTAACATATGTGAAATGGCTTCTTTCAGGAGAGGAGGCGTTCTCTTATGGCTATGGAGGAACAGGAAAAAAGTCTACCAATTACAAATTTGGAGACTATGGAGAGAAATTTGGTGAAGGCGATATCATTGGATGTTATATTGTAAGTGCTATTAATTTTTTTCTGCTTTTTTGCTTTGAATATTGAATCTGTCATCTTAGTAGCTGTTTTATTGTTCGCACAGAGCATTAGCGATAACACTTCTCAATTTCTTTCAATTACCTTCAACGGAGTGATGTCAAGCACTGGCAAAATGAATTGTGATTTTGATGAGTCTCGTTGGGTCCATTGCTCACAGCAGAATTTGTAAAATAAACTGTTCAAACACAAATATAGTAAAAGGCATCAGCCAATCAGATTGCTTTCTACAAATACAAGTGCATATGCTAGCTAATCATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23344
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059360 Nonsense 506 784 12 16
Genomic Location (Zv9):
Chromosome 18 (position 34156333)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 35835489
GRCz11 18 35816497
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCTCTTTTGTCACTTTGTCTAGACAAATGTATATGGATCAGCCCAGAGA[C/T]GAAAGATGCGCCCTTTTGAAGGGTTTCACCGTAAGGCTGTTGTAATTTGC
Long Flanking Sequence:
CAAAGTTTTGCCGCAGTGCTACCTTTTGGTCAAATGTTATAACGATATTTATAAAAGTGCTAATAACTTTTGACTAATTTTGCCCATTGTTATAATAGTTGTCTTCATACATTTCTTGGGTATAAGATCGATACTAATTATGCCTTAAATAACTGAACGTTCTGCCTGCCATCTTGCCTATAGGCAAAAACCTACTTTTTCTAACTCCTCCTACATTGCTTGCAGCTATATTTTGTTTTGTTTTTACAGTGGTCTTAATAGTTTTACATTTTTCCAACCTTATTACAAAGAGTCTCTAATAAGATTTTTGTTCCAGTATGCTGGGTTTCATAGACTTCTGTTTGGATTCTATTGCAGGGTTGATTTTTTTTAAAGATAAATCAGAGCTGGGATGAACAAAAAATAAATAAACAAAACACAAAAACAACCACAATAATCAACTGCTTCTACTTCTCTTTTGTCACTTTGTCTAGACAAATGTATATGGATCAGCCCAGAGA[C/T]GAAAGATGCGCCCTTTTGAAGGGTTTCACCGTAAGGCTGTTGTAATTTGCCCGAGGGATGAGGATTTAAAGGAACGAAGGTGTAAGCAAGCTGAGGATGGGAAAGATGTGCCCGATCAAGCCGTTTTAGAAATGAAAGGTAGGAACTCTGCTGTAAAAAACAACATCATAAATCACTAAATAGGTCTGCAAAATTTTATTTAATCTTTATTTGTAATTAAAATAGGAACGCATTAAAGAATAAAAATGAAAAATGGGATGCTACAAACTGAGCATGACATTCATTTAACATTCAACTTAAGTTTATGAAAGTGGTTTTTATACACAGTTGGAGGCAAAAAAAATGTGTCCTACTGTAAAAGTTTTAATTCATTTTTAAATATTTTTTAAGTGATTTTTTTTTTTCTAATGTTTAGACTTTTAACAGCTTATTTCTAATAGCTAGTTTATTTTTTTATTGCATGATGACAGGATAGAATATTTTACTGGTTATTTTGCAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36693
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059360 Essential Splice Site 687 784 14 16
Genomic Location (Zv9):
Chromosome 18 (position 34154102)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 35833258
GRCz11 18 35814266
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACTACAATAATAGTCGCTATGGCTCTTATAACAAAGAGGGATATGGTCAA[G/A]TGAGTGCTTTATGTGGCTTATCAGTTTTTATTTGTGACAAATATTTAGTT
Long Flanking Sequence:
CAAAGCCAACTTTGTGCTGCCAGAGGCGGGAGATTTCCTGGATGAAGTGATGTTCATCGAGCTGCAGAGAGACGAAGCTCGAGACTTGATCAAACGCTACAATGAGGAAGGTCGGAAGGCTGGACCTCCTCCTGAAAAACGCTTCAACAGCTGGGGAGACAGAAGACGTGAAAACAACAACAACCAGAGGTACGACAGTCATGGAGGATCAAGAGGAGGCCATCAGAGCAGAGGAGGATCTGGAGGAGGCTACAGCGGAGGAGGTCAGTTGAACTTATTAGCTCTCATGCAATCTGATTCAGTTTTGACTGCTCTGTCATTAGTCATTTTCTTGCTTTGCGTTTTGGTCAGGTTATAATCGTGATGGCTACAGTCAGAACCGCTGGGGAGGGAATTACAGAGACAGTCGAGACGGATACAGCAGCAGCAGCAGCCATCAAACTGGAGGAAACTACAATAATAGTCGCTATGGCTCTTATAACAAAGAGGGATATGGTCAA[G/A]TGAGTGCTTTATGTGGCTTATCAGTTTTTATTTGTGACAAATATTTAGTTGCATAAGATGTTTGTTTGTATTTTTTTAACGTGTGTTTGATCTTTTCTTTTTTTGTTTTGGATTCGTTTTTATATGTTTATTATTAATTTCTTTGTTTATTTATAAAATGTTTTTTTTTTGTTAAATTTTGTTTTGTTTTTTTTGTAAAAATATTTTTTTGTTTTTGCTTATTGAATTGTTTAGTTTGTATGTTTTATTTGTTTGTTTTTATTGGATTAAAAAAAGTATTCCAGCATTCCAAGGTAGAAAATATGTCTGCACAATATATCGCTTCAGCATCAATATCACATGTGATCATTTACAATATTCACATTGCAGGATATGCTGAGTTTCTATTTTGAATCTTTTTTTTATTTTATTGATCCATGCTTGTAGAATGTTTATTATACAGTGGTGCTTCGTTATTCGCGGGAGTTATGTTTTAAAATTAATCCGACATATGTGAAATC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4761
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059360 Nonsense 712 784 15 16
Genomic Location (Zv9):
Chromosome 18 (position 34150561)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 35829717
GRCz11 18 35810725
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGCAACCAGAGCAGCTATGGCCAAGGAAATTACAACCAAGGCTACAACTA[T/A]GGCAACTATAATCAGTACCCAGGATATGGGCAAGGGTATCAGGACAATCA
Long Flanking Sequence:
GCCGTGGTGGGATCAATTTTGGCAAGGCGCCCCGCCATGGAAGTATGAATGTAGTGGAAACCATGGAGGTGTTTTCATAAACGCTGCCTCTAGAGCAGGAATCTCCAAACTTGTTCCTGGAGGGCCGATGTCCTGCAGATTTTAGCTCCAACCCTAATCAAACACACCTGAACAAGCTAATCAAGGTCTTACTTGCTATACTTAAAACACCCAGGCAGGTGTGTTGAGGCAAGTTGGAGCTAAACCCAGCAGGGCACTGGACCTCCAGGAACGAGATTGGTGACCCCTGCTTTAGAGTCACTTCCTGACAGTGCAGCGAGGCAACAAGTCAGCCCACTAAGCTTTCTGACATAGCCCTTTTTTCTTTGCATTCTGTTTTATTTTATATTTGTCTGTGTTTTTGTTTCCACATATCATCATCCTCAGGGTTATAATCAAGGCTACAACCAGGGCAACCAGAGCAGCTATGGCCAAGGAAATTACAACCAAGGCTACAACTA[T/A]GGCAACTATAATCAGTACCCAGGATATGGGCAAGGGTATCAGGACAATCAAGGATCTGGACAATCCTACAACCAGCAGAACTATAATCAGCAGTATCAACAGGTCAGTTACTGTGAATCCTTTCTGATTTCGAAGAATACTAAAAGTAATGGCAAACAAATTACATTTAGGTGATTTGTTACAAAAAATGCATCAGTTAACTGGTAGCGGCAGAAAAGACGTCTTTGTACACACACATTTAAAATTGGCAGTTGAAATTACCACTTAAAATGTTGTATCAGTTACTGGACTCTTGTGTGGTAGCTGGTGTCAAAGGAACTGGCTTTAAGGGTCATGAAACCCCCCTCTTAGGCTTCAAGTCTACCTCAGAATTCTTTAAAAAAAAAATGCTTCAAAATGGGCATGGAGCGTTGCGAGCAGAGGGAGGAGTGTGGGGGAAAAGAAGGGAGTGAACAACTGTCATTTGGCTTGCATAATGAGACACAAACTGTGAGGAGACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa705
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059360 Nonsense 746 784 15 16
Genomic Location (Zv9):
Chromosome 18 (position 34150461)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 35829617
GRCz11 18 35810625
KASP Assay ID:
554-0613.1 (used for ordering genotyping assays)
KASP Sequence:
AAGGATCTGGACAATCCTACAACCAGCAGAACTATAATCAGCAGTATCAA[C/T]AGGTCAGTTACTGTGAATCCTTTCTGATTTCGAAGAATACTAAAAGTAAT
Long Flanking Sequence:
ATCTCCAAACTTGTTCCTGGAGGGCCGATGTCCTGCAGATTTTAGCTCCAACCCTAATCAAACACACCTGAACAAGCTAATCAAGGTCTTACTTGCTATACTTAAAACACCCAGGCAGGTGTGTTGAGGCAAGTTGGAGCTAAACCCAGCAGGGCACTGGACCTCCAGGAACGAGATTGGTGACCCCTGCTTTAGAGTCACTTCCTGACAGTGCAGCGAGGCAACAAGTCAGCCCACTAAGCTTTCTGACATAGCCCTTTTTTCTTTGCATTCTGTTTTATTTTATATTTGTCTGTGTTTTTGTTTCCACATATCATCATCCTCAGGGTTATAATCAAGGCTACAACCAGGGCAACCAGAGCAGCTATGGCCAAGGAAATTACAACCAAGGCTACAACTATGGCAACTATAATCAGTACCCAGGATATGGGCAAGGGTATCAGGACAATCAAGGATCTGGACAATCCTACAACCAGCAGAACTATAATCAGCAGTATCAA[C/T]AGGTCAGTTACTGTGAATCCTTTCTGATTTCGAAGAATACTAAAAGTAATGGCAAACAAATTACATTTAGGTGATTTGTTACAAAAAATGCATCAGTTAACTGGTAGCGGCAGAAAAGACGTCTTTGTACACACACATTTAAAATTGGCAGTTGAAATTACCACTTAAAATGTTGTATCAGTTACTGGACTCTTGTGTGGTAGCTGGTGTCAAAGGAACTGGCTTTAAGGGTCATGAAACCCCCCTCTTAGGCTTCAAGTCTACCTCAGAATTCTTTAAAAAAAAAATGCTTCAAAATGGGCATGGAGCGTTGCGAGCAGAGGGAGGAGTGTGGGGGAAAAGAAGGGAGTGAACAACTGTCATTTGGCTTGCATAATGAGACACAAACTGTGAGGAGACCCATAATTTATAGCTTACAAAGTTAAAATGCAAAGAAATAAATAGTAATTTAATGTCCTGCCACATATGTTATTCATAATTTCATATACACATAAACACAA
Associated Phenotype:
Not determined