Busch Lab

ZMP

sc:d0144

Ensembl ID:
ENSDARG00000040543
ZFIN ID:
ZDB-GENE-080229-4
Description:
transmembrane glycoprotein A33 [Source:RefSeq peptide;Acc:NP_001108577]
Human Orthologues:
C1orf204, GPA33
Human Descriptions:
chromosome 1 open reading frame 204 [Source:HGNC Symbol;Acc:27647]
glycoprotein A33 (transmembrane) [Source:HGNC Symbol;Acc:4445]
Mouse Orthologue:
Gpa33
Mouse Description:
glycoprotein A33 (transmembrane) Gene [Source:MGI Symbol;Acc:MGI:1891703]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa19395 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa25502
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059335 Essential Splice Site 197 448 4 7
Genomic Location (Zv9):
Chromosome 1 (position 547932)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 68048
GRCz11 1 68048
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTACGATGTGTTGAACAACCCTCGCCCAAACCCACTGAAGGCCACCGACG[G/A]TACGCGTGTACAAACCTGCTGAATCCCTGAGTTCCTGCATCAGCTATAAG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3380
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059335 Nonsense 224 448 5 7
Genomic Location (Zv9):
Chromosome 1 (position 548107)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 67873
GRCz11 1 67873
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCTCTAARGACACGTCCGGGTTCTACGTCTGCACCTCCACCAATGAAATC[A/T]GATCTGCCAAGTGTAATCTGACTATGGCCGTCATGGCACGTAAGAATCGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19395
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059335 Nonsense 335 448 7 7
Genomic Location (Zv9):
Chromosome 1 (position 548592)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 67388
GRCz11 1 67388
KASP Assay ID:
2259-0032.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACGAGCGCAGCGAGAGGAGCTACGACCGCCGCAGTGACTACGACGACCGC[C/T]GAGATCCGAACACCAGCCAGCGGGATGATCGTGATGACCGATACAATGAC
Associated Phenotype:
Not determined