Busch Lab

ZMP

spsb4b

Ensembl ID:
ENSDARG00000040538
ZFIN IDs:
ZDB-GENE-030131-7719, ZDB-GENE-030131-7719, ZDB-GENE-040801-213
Description:
splA/ryanodine receptor domain and SOCS box containing 4b [Source:RefSeq peptide;Acc:NP_001003474]
Human Orthologues:
SPSB1, SPSB2, SPSB4
Human Descriptions:
splA/ryanodine receptor domain and SOCS box containing 1 [Source:HGNC Symbol;Acc:30628]
splA/ryanodine receptor domain and SOCS box containing 2 [Source:HGNC Symbol;Acc:29522]
splA/ryanodine receptor domain and SOCS box containing 4 [Source:HGNC Symbol;Acc:30630]
Mouse Orthologues:
Spsb1, Spsb2, Spsb4
Mouse Descriptions:
splA/ryanodine receptor domain and SOCS box containing 1 Gene [Source:MGI Symbol;Acc:MGI:1921896]
splA/ryanodine receptor domain and SOCS box containing 2 Gene [Source:MGI Symbol;Acc:MGI:1315199]
splA/ryanodine receptor domain and SOCS box containing 4 Gene [Source:MGI Symbol;Acc:MGI:2183445]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa22718 Essential Splice Site Available for shipment Available now
sa2792 Nonsense F2 line generated Not yet available

Mutation Details

Allele Name:
sa22718
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059327 Essential Splice Site None 281 1 4
ENSDART00000143447 None None 281 None 2
Genomic Location (Zv9):
Chromosome 15 (position 40215640)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 41732347
GRCz11 15 41689743
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACGAGTATTTTTTTTGTCTGAACTCAACCGACGAGGGATTCTCGCGAGAG[T/C]AAGTAACGTTACATCAGCGCGTGGCTGGTTTGTTTGTGTTTGTGCTTCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2792
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059327 Nonsense 32 281 3 4
ENSDART00000143447 Nonsense 32 281 1 2
Genomic Location (Zv9):
Chromosome 15 (position 40203440)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 41720147
GRCz11 15 41677543
KASP Assay ID:
554-2704.1 (used for ordering genotyping assays)
KASP Sequence:
AGGAGGTGGGTGAGCTGGCGTATYCACCAGTGTGTGCGGCGCTTCGAAAT[C/T]GAGGTGTCCCTTTACCTGCCCGTCTGGAGCTGCTGTTGGATATGCCTCCG
Associated Phenotype:
Not determined