Busch Lab

ZMP

lgals3bpb

Ensembl ID:
ENSDARG00000040528
ZFIN ID:
ZDB-GENE-040426-2262
Description:
Galectin-3-binding protein B [Source:UniProtKB/Swiss-Prot;Acc:Q6NY73]
Human Orthologue:
LGALS3BP
Human Description:
lectin, galactoside-binding, soluble, 3 binding protein [Source:HGNC Symbol;Acc:6564]
Mouse Orthologue:
Lgals3bp
Mouse Description:
lectin, galactoside-binding, soluble, 3 binding protein Gene [Source:MGI Symbol;Acc:MGI:99554]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa15385 Nonsense Available for shipment Available now
sa18128 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5233
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059314 Nonsense 6 561 1 6
ENSDART00000101829 Nonsense 5 572 1 5
ENSDART00000059314 Nonsense 6 561 1 6
ENSDART00000101829 Nonsense 5 572 1 5
Genomic Location (Zv9):
Chromosome 3 (position 58558137)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 57673725
GRCz11 3 57744249
KASP Assay ID:
2259-4207.1 (used for ordering genotyping assays)
KASP Sequence:
GTGAATTGCATCCTTGTCGTTGCTGTTTCTGACATCATGTTGCTCCTGTG[G/A]CCTCTACTGTTTCTTCARGTTTCYGCACTGCGCCGGACCTTGTTTGGTAT
Long Flanking Sequence:
GTGTAACTAGTACTTCACATAGTGGCTGTTAATGAAACCAGACACAGATGAGACTGACTGGAAACAAATGATCAGGAGCAGCCTCTGGGAAAACAGGCTCTACAGACCCCAGGAAAGCAGACCTAACCCCTATTCTGGCAATTCACTTGCCAGCAAAGAGATTCATAAGTTATTATGGGTTATCAATAGGGCAAGTGACTGGTGATTGTTTTGGGGAACACTGTATTGTGGGATTTTAGTTTGACTAACACCTCATGTGGCTAAACTTAACCCAGACTTTGCTGACAAACAGTTCTTATCGAAACTTCCCAAATTGTACATTTTCATGAAACGAAACTTTTGGTGTCCTAGAAATGTGATTGCGCAGCGTTTCGTTAAAGTTTCACAATTGCAAACTTGATTTGGCCGTTATTTAAAGGAAAGCCAAGATGCTTTGTAAGTCATTCAGTTGTGAATTGCATCCTTGTCGTTGCTGTTTCTGACATCATGTTGCTCCTGTG[G/A]CCTCTACTGTTTCTTCAGGTTTCTGCACTGCGCCGGACCTTGTTTGGTATGTAAACCGTTGGATTATAAGTTTAACATACACTGTTGTTTGCATTAATTTAGCAGGATTTCACAGGTTTAACACTATCATTATTTAACCTAAATATTTTAAAATCTGGCTGAAGACCGACCAAAGCAGCTAATGCAGGAGGGAAGAGTGAGACTGGTTGGAGTTATTCCCTCGTCTGGCCGTGTGGAGGTCTACCATGATGGACAGTGGGGTACGGTCTGTGATGACGGATGGGATCTGGCCGAAGCGCAGGTGGTGTGTCGTCAGCTGGGTTTTCCTGGAGCCGTATCAGTTGCTACTGGAGGACAATATGGTGAAGGTACAAACTCCACTGTGCAGTTTGATTGCCACCTTTAAAACTTTAAGACCATATCTAATTCTGGCCAAAATGCTGTTGATGTGTTCAGGATCTGGTCGAGTCTGGCTGGATGATATGAACTGTAAAGGCTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15385
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059314 Nonsense 6 561 1 6
ENSDART00000101829 Nonsense 5 572 1 5
ENSDART00000059314 Nonsense 6 561 1 6
ENSDART00000101829 Nonsense 5 572 1 5
Genomic Location (Zv9):
Chromosome 3 (position 58558137)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 57673725
GRCz11 3 57744249
KASP Assay ID:
2259-4207.1 (used for ordering genotyping assays)
KASP Sequence:
GTGAATTGCRTCCTTGTCRTTGCTGTTTCTGACATCATGTTGCTCCTGTG[G/A]CCTCTACTGTTTCTTCARGTTTCYGCACTGCGCCGGACCTTGTTTGGTAT
Long Flanking Sequence:
GTGTAACTAGTACTTCACATAGTGGCTGTTAATGAAACCAGACACAGATGAGACTGACTGGAAACAAATGATCAGGAGCAGCCTCTGGGAAAACAGGCTCTACAGACCCCAGGAAAGCAGACCTAACCCCTATTCTGGCAATTCACTTGCCAGCAAAGAGATTCATAAGTTATTATGGGTTATCAATAGGGCAAGTGACTGGTGATTGTTTTGGGGAACACTGTATTGTGGGATTTTAGTTTGACTAACACCTCATGTGGCTAAACTTAACCCAGACTTTGCTGACAAACAGTTCTTATCGAAACTTCCCAAATTGTACATTTTCATGAAACGAAACTTTTGGTGTCCTAGAAATGTGATTGCGCAGCGTTTCGTTAAAGTTTCACAATTGCAAACTTGATTTGGCCGTTATTTAAAGGAAAGCCAAGATGCTTTGTAAGTCATTCAGTTGTGAATTGCATCCTTGTCGTTGCTGTTTCTGACATCATGTTGCTCCTGTG[G/A]CCTCTACTGTTTCTTCAGGTTTCTGCACTGCGCCGGACCTTGTTTGGTATGTAAACCGTTGGATTATAAGTTTAACATACACTGTTGTTTGCATTAATTTAGCAGGATTTCACAGGTTTAACACTATCATTATTTAACCTAAATATTTTAAAATCTGGCTGAAGACCGACCAAAGCAGCTAATGCAGGAGGGAAGAGTGAGACTGGTTGGAGTTATTCCCTCGTCTGGCCGTGTGGAGGTCTACCATGATGGACAGTGGGGTACGGTCTGTGATGACGGATGGGATCTGGCCGAAGCGCAGGTGGTGTGTCGTCAGCTGGGTTTTCCTGGAGCCGTATCAGTTGCTACTGGAGGACAATATGGTGAAGGTACAAACTCCACTGTGCAGTTTGATTGCCACCTTTAAAACTTTAAGACCATATCTAATTCTGGCCAAAATGCTGTTGATGTGTTCAGGATCTGGTCGAGTCTGGCTGGATGATATGAACTGTAAAGGCTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18128
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059314 Nonsense 84 561 2 6
ENSDART00000101829 Nonsense 85 572 2 5
Genomic Location (Zv9):
Chromosome 3 (position 58557781)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 57673369
GRCz11 3 57743893
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGTGTCGTCAGCTGGGTTTTCCTGGAGCCGTATCAGTTGCTACTGGAGGA[C/T]AATATGGTGAAGGTACRAACTCCACTGTGCAGTTTGATTGCCACCTTTAA
Long Flanking Sequence:
TGATTGCGCAGCGTTTCGTTAAAGTTTCACAATTGCAAACTTGATTTGGCCGTTATTTAAAGGAAAGCCAAGATGCTTTGTAAGTCATTCAGTTGTGAATTGCATCCTTGTCGTTGCTGTTTCTGACATCATGTTGCTCCTGTGGCCTCTACTGTTTCTTCAGGTTTCTGCACTGCGCCGGACCTTGTTTGGTATGTAAACCGTTGGATTATAAGTTTAACATACACTGTTGTTTGCATTAATTTAGCAGGATTTCACAGGTTTAACACTATCATTATTTAACCTAAATATTTTAAAATCTGGCTGAAGACCGACCAAAGCAGCTAATGCAGGAGGGAAGAGTGAGACTGGTTGGAGTTATTCCCTCGTCTGGCCGTGTGGAGGTCTACCATGATGGACAGTGGGGTACGGTCTGTGATGACGGATGGGATCTGGCCGAAGCGCAGGTGGTGTGTCGTCAGCTGGGTTTTCCTGGAGCCGTATCAGTTGCTACTGGAGGA[C/T]AATATGGTGAAGGTACAAACTCCACTGTGCAGTTTGATTGCCACCTTTAAAACTTTAAGACCATATCTAATTCTGGCCAAAATGCTGTTGATGTGTTCAGGATCTGGTCGAGTCTGGCTGGATGATATGAACTGTAAAGGCTCAGAGAGCTTATTGTCTGAATGCAGCTTCAAAGGCTGGGGTGTTTCTGACTGCACGCATAAAGAGGATGCAGGAGTGATCTGCGCGCCTGGTAAGTTCAGAAGAGAGTTACCTTTTTGTCCACTCATGTTTCTTTTATTTATGCTATCCTGATCTGTTTGGTTGCATTTTCTTTCAAGGTAAAAACACAACCAGCATTCGACAGATGTCTGTGGACAACAGTCTGGGATTGTCAGATGATCTCGGTCTTCTGTTTGACAGTGAAGACGGTTGCGATTTCACCATTGCTGTTCGAGATCTCAGTGAAGAGGCTGAATTGACTTTTTGTGTGCACCGTGTGATCCTCATGATCTATCCAG
Associated Phenotype:
Not determined