Busch Lab

ZMP

mthfd1

Ensembl ID:
ENSDARG00000040492
ZFIN ID:
ZDB-GENE-020905-4
Description:
C-1-tetrahydrofolate synthase, cytoplasmic [Source:RefSeq peptide;Acc:NP_955823]
Human Orthologue:
MTHFD1
Human Description:
methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1, methenyltetrahydrofolate cyclohydrolase
Mouse Orthologue:
Mthfd1
Mouse Description:
methylenetetrahydrofolate dehydrogenase (NADP+ dependent), methenyltetrahydrofolate cyclohydrolase,

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa473 Nonsense Confirmed mutation in F2 line Not yet available

Mutation Details

Allele Name:
sa473
Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021950 Nonsense 615 934 19 28
Genomic Location (Zv9):
Chromosome 17 (position 49524061)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 49285145
GRCz11 17 49368120
KASP Assay ID:
554-0205.1 (used for ordering genotyping assays)
KASP Sequence:
GGAAGTTTTGTTTGTTTTAGGGAGTGTGTGGAGCTCTGACAGTCCTCATG[C/T]GAGATGCTATCAAGCCAAACCTCATGCAGACTCTGGAGGTGAGTGTTGTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3990
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021950 Nonsense 815 934 24 28
Genomic Location (Zv9):
Chromosome 17 (position 49515226)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 49276310
GRCz11 17 49359285
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CGAGCTGTTCAAAGAGCTGCAGACCTGCCCAAMAGCTTCCAATTTCTCTA[T/A]GATGTTCAGGTAAAAATAAAGCAGAATGTTAGTACTGTTGCATTAAAACT
Associated Phenotype:
Not determined