Busch Lab

ZMP

si:dkey-15j7.2

Ensembl ID:
ENSDARG00000040482
ZFIN ID:
ZDB-GENE-100921-38
Human Orthologue:
OSBPL3
Human Description:
oxysterol binding protein-like 3 [Source:HGNC Symbol;Acc:16370]
Mouse Orthologue:
Osbpl3
Mouse Description:
oxysterol binding protein-like 3 Gene [Source:MGI Symbol;Acc:MGI:1918970]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa6425 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa4654 Nonsense F2 line generated Not yet available
sa14092 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2848
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059250 Splice Site, Nonsense 71 846 2 21
ENSDART00000145886 Splice Site, Nonsense 40 848 1 21
Genomic Location (Zv9):
Chromosome 16 (position 23409178)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 21518929
GRCz11 16 21324748
KASP Assay ID:
554-2863.1 (used for ordering genotyping assays)
KASP Sequence:
AGGCCGGCTTTATGCTYAAGAAAAGAAAATGGCCCATGAAAGGCTGGCAC[A/T]AGGTATGTGATCGAATTTGYMTTGCTTTAAAGCCTKCACCAAAGTTTTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6425
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059250 Essential Splice Site 460 846 12 21
ENSDART00000145886 Essential Splice Site 465 848 12 21
Genomic Location (Zv9):
Chromosome 16 (position 23449835)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 21559586
GRCz11 16 21365405
KASP Assay ID:
554-4511.1 (used for ordering genotyping assays)
KASP Sequence:
TCCATGGATAACTTCAGCAACGAGGCAGAGAATGAGAGACTYAATACAGG[T/C]GGGAATGACGCTTTTCTTGCCTCATGCTGCTGATTTTTCACTGTCAATCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4654
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059250 Nonsense 673 846 17 21
ENSDART00000145886 Nonsense 675 848 17 21
Genomic Location (Zv9):
Chromosome 16 (position 23483417)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 21593168
GRCz11 16 21398987
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AACGCTGGATTGAGCACTATGGKGAAATTTCCATCAAAAACTCCAACAGC[G/T]AGAAATGCCAGTGCAAAGTTACCTTCATCAAGGTCAGMTGCCTCTGCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14092
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059250 Nonsense 740 846 19 21
ENSDART00000145886 Nonsense 742 848 19 21
Genomic Location (Zv9):
Chromosome 16 (position 23491580)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 21601331
GRCz11 16 21407150
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTTGTCTGTGTATGTTTATCTGTACAGATCCCATGCCTCCTGAATTTGAG[C/T]AGTACTACGGTTTTACAAAGTTTGCTATGGAGCTCAATGAGCTCGACCCT
Associated Phenotype:
Not determined