Busch Lab

ZMP

zgc:55856

Ensembl ID:
ENSDARG00000040433
ZFIN ID:
ZDB-GENE-040426-822
Description:
hypothetical protein LOC393204 [Source:RefSeq peptide;Acc:NP_956529]
Human Orthologue:
CYP2W1
Human Description:
cytochrome P450, family 2, subfamily W, polypeptide 1 [Source:HGNC Symbol;Acc:20243]
Mouse Orthologue:
Cyp2w1
Mouse Description:
cytochrome P450, family 2, subfamily w, polypeptide 1 Gene [Source:MGI Symbol;Acc:MGI:3616076]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa19948 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa19948
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015232 Nonsense 154 503 3 9
ENSDART00000134497 Nonsense 127 234 4 6

The following transcripts of ENSDARG00000040433 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 8826746)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 8364213
GRCz11 3 8241955
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGCGCTGTCAAACCTACGAGACTTTGGAATGGGCAAAAAGAGAAGTGAA[G/T]AACTGATCACTGAAGAGATCAAATATCTAAAGGAGGAAATTGAGAGGTTT
Long Flanking Sequence:
AGACTAAAAAGGGCATGTGCACTGCACAGGTTGAGCCCTATGTGTGCACGTGGCTGGACGCAACATTAAGGTAGGAAAATACAGAAATCCGGATTTCTGGCGAAACATCCCTTACATTACATCCTATAACAATTCATGGCTTTCATCTTTTTTATCTTACAGCTGTCAAAACAATATGGGCCAGTTTACACAGTGCATATGGGCCCTAGGACAGTGGTAGTCCTGTCAGGATACAAGGCGGTCAAGGAGGCACTGGTGAACCTTTCAGAGGAGTTTGGAGAAAGAGATATCTCACCCATATTCCAGGATTTCAATGAGGGTTATGGTAAGAGGACTTTCTCATCTTCATCCACATTTTTATTATAGTTAGAAACAAGAAGTCCACTTTTAATCGTTCCCCTGCAGGGATAGTTTTTTCCAATGGTGAGAACTGGAAGGAAATGAGACGCTTTGCGCTGTCAAACCTACGAGACTTTGGAATGGGCAAAAAGAGAAGTGAA[G/T]AACTGATCACTGAAGAGATCAAATATCTAAAGGAGGAAATTGAGAGGTTTGGAGGTAAGACTGTAAAACTTCAGGACATGATAATGATGTGACTTTAAATGATTTGAGTATTAAAGGGAAACTTCACCCACAAAAAGTCAAATGCTGTAAATAATCACTCACCCTCATGTTGTTTCCAGCTTGGAATACCTTTGTTCATCTTCAAAACACAAATAAAGATGTTTTAGATCAGGGGTGCTCAATCCTGTTCCTGGAGATCTACCCTCTTGCAGATTTCAATTGCTACCCATATCAACCACACCTGAACCAATTAATTAGGAGCTGAACACCACTTGATAATTACAGGCAGGTGTGTTTGATATGGGTAGCAACTGAAATCTGCAGGAAGGTGGATCTCCAGTAACAGGATTCCCTGCTGAAAAATCCAGCTTAAACCAGCCTAGGCTGGTTGGCTGGTTTTAGCTGGTCGACCAGGCTGGTTTTAGAGGGGTTTTGGCCAC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa25996
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015232 Essential Splice Site 332 503 6 9
ENSDART00000134497 None None 234 None 6

The following transcripts of ENSDARG00000040433 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 8821741)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 8359208
GRCz11 3 8236950
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACGCTACGTTGGGGTCTTCTGCTAATTGCCAAATACCCTGAAATACAAG[G/A]TACTAGTAAAACATTAACAAAAACAAAAAAGTATATATATATATATATAT
Long Flanking Sequence:
CTGAAATAGCACATTGTGAACAGTAGAATAAGTGTGATTTATTGCTATTTCTCAGAGTTTTTATGCTTGTTTGTAGCTCTACAACATGTTTCCTTGGCTTCGTCTGTTTGTGGCAAATCAAAAGCGTGTTGTGGACAATGTCCAAGAATCCTTTAAACAAATTGGGGAAATAGTGAATGGTTTGAAGAAGACTCTGAACCCGCAATCCCCCAGAGGAATCGCTGACAAATTCCTCATTCAGCAGCAGAAGGACAAGGTACTGTTTAATGTTTAAAATATGCTTGCTTTATTATTATTTTATTTGTTACTTTATTTATTGCATTTTAAAGTTCTCACTTTTTTGGATTTCACCCTGCAGGAATCTGGCAAAACAGACTCATTGTACAATTCAAATAATTTCCTTACTACAATTAACAACCTGTTTGGTGCTGGTATTGACACAACAGTCACAACGCTACGTTGGGGTCTTCTGCTAATTGCCAAATACCCTGAAATACAAG[G/A]TACTAGTAAAACATTAACAAAAACAAAAAAGTATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATTGAGGCAAGAGAAAGGGAAAACACAGACAATAAACAAAGATGGTATAGTAAATACTGCAATCATTATCGCTGATCATCCACTGGACAATGGGTGTGGAGAGGTTTGCATGGGGGAAACAGTTCACTGGCATTTTCTTTCTACTCCTGTGCTTATAATTTCTCTTTGGAATTGGATTCAGCTGATGGTGACTGGAGTTGATTGTGCTGAATCTAAGTTTGTGTCCAGGGTTATGCTGCATTAAAAGGCCCGCCACATTCCCAGATGATGGTCCTTCCTAGCAGGTAGTATATCAGCTACTGGACCTGCCCAGTTCATGGAAAGGGTCTCCCTCTCCAAGGCTGAGCTTCCGGGTCAAGTACACTATGCCTTGCTCTTCCCCATCATGGACCTATGATAG
Associated Phenotype:
Not determined