Busch Lab

ZMP

si:ch211-8c17.7

Ensembl ID:
ENSDARG00000040426
ZFIN ID:
ZDB-GENE-091113-5
Human Orthologue:
CYP2W1
Human Description:
cytochrome P450, family 2, subfamily W, polypeptide 1 [Source:HGNC Symbol;Acc:20243]
Mouse Orthologue:
Cyp2w1
Mouse Description:
cytochrome P450, family 2, subfamily w, polypeptide 1 Gene [Source:MGI Symbol;Acc:MGI:3616076]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa33104 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa33104
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059174 Nonsense 51 528 1 9
Genomic Location (Zv9):
Chromosome 3 (position 12548847)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 12566802
GRCz11 3 12718251
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCCAGCACAAGTGCATTGCTGGGAGCTTTGCTGTTGTTACTGGTTTTATA[T/A]CTAGCTTCATCTGGATCCACATCTCAGAAAGAAGGGAAAGAGCCGCCGGG
Long Flanking Sequence:
ATGCATATGAAAATAGGATGAGTACATTTTGATTACATGGTGACTTTAAACAGATGAAGACTTCACTCAGAATTGTAAGCTGAAAAAGTAGCTATGAATATGTATTAAATTTTTCTAATGGTGTCAAATTGGTGTTACTGACCTAAACACACACAGTGCCCAATGTAAGGCAGGACGTTACTATGGTTTAAAGACTGATAAAAATCAGTATTTGTGTATCAGTTCAGATCTGCTTGCTATTGGCTTTCTGGAAAAGGTTAATGTTATACCACAGGGTGTCATATTATTGCCTATACAACTATACCTGCCACTATACATGCCCTTTATTCACACAGATTTATTTAGAACGAGGCAAGGTCCCTCCTCCATATAGCAGCTATAAAATTACTGAGTACATCAGTTGCGAAGCTCAGAAAGAAAATGGCTGTTGTCGAGTCACTTCTGCAGTTTGCCAGCACAAGTGCATTGCTGGGAGCTTTGCTGTTGTTACTGGTTTTATA[T/A]CTAGCTTCATCTGGATCCACATCTCAGAAAGAAGGGAAAGAGCCGCCGGGACCCAAACCACTGCCACTGGTGGGAAACCTGCTGACCCTTGACCTCACAAGATCCTTTGACACTTTTTTTGAGGTGAGAACTCAATACACAGAATAAACAGTAGCCTATTATTTTGAGATTTGTCTTAAGTGTCCTTTTCTGTGTCCTCCAGCTGTCCAAAACGTATGGAAATATATTCCAAGTATTTTTGGGACACAGAAAAACTGTAGTCCTAGTTGGATACAAAACTGTAAAAGAAGCGCTTGTGAACTACGCTGAAGTGTTCGGTGATCGAGAGATTGGACCTGGTTTCAAGTTGAAGGATGAAGAACATGGTAAGACTCTTTTTCTACCTCGAATGAATGTTCACGCAATAAATGCAAGACATGTTGCAAACCAAACAAGCTGGCCACTTTAACAATGAAAAACCTAACAATAAACCTAAAGCTAGTAACTCGTAAAAAGGCCAG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5188
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059174 Nonsense 95 528 2 9
Genomic Location (Zv9):
Chromosome 3 (position 12548638)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 12567011
GRCz11 3 12718460
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTATTTTGAGATTTGTYTTAAGTGTCCTTTTCTGTGTCCTCCAGCTGTCC[A/T]AAACGTATGGAAATATATTCCAAGTATTTTTGGGACACAGAAAAACTGTA
Long Flanking Sequence:
ATTTGTGTATCAGTTCAGATCTGCTTGCTATTGGCTTTCTGGAAAAGGTTAATGTTATACCACAGGGTGTCATATTATTGCCTATACAACTATACCTGCCACTATACATGCCCTTTATTCACACAGATTTATTTAGAACGAGGCAAGGTCCCTCCTCCATATAGCAGCTATAAAATTACTGAGTACATCAGTTGCGAAGCTCAGAAAGAAAATGGCTGTTGTCGAGTCACTTCTGCAGTTTGCCAGCACAAGTGCATTGCTGGGAGCTTTGCTGTTGTTACTGGTTTTATATCTAGCTTCATCTGGATCCACATCTCAGAAAGAAGGGAAAGAGCCGCCGGGACCCAAACCACTGCCACTGGTGGGAAACCTGCTGACCCTTGACCTCACAAGATCCTTTGACACTTTTTTTGAGGTGAGAACTCAATACACAGAATAAACAGTAGCCTATTATTTTGAGATTTGTCTTAAGTGTCCTTTTCTGTGTCCTCCAGCTGTCC[A/T]AAACGTATGGAAATATATTCCAAGTATTTTTGGGACACAGAAAAACTGTAGTCCTAGTTGGATACAAAACTGTAAAAGAAGCGCTTGTGAACTACGCTGAAGTGTTCGGTGATCGAGAGATTGGACCTGGTTTCAAGTTGAAGGATGAAGAACATGGTAAGACTCTTTTTCTACCTCGAATGAATGTTCACGCAATAAATGCAAGACATGTTGCAAACCAAACAAGCTGGCCACTTTAACAATGAAAAACCTAACAATAAACCTAAAGCTAGTAACTCGTAAAAAGGCCAGTGTGTTGTTAACCAGTCATTCAATGCGTATAAGCAGACACAGTAAATGTCCCAGAAGTTGAAAGATAGTGGGCCCTATCATACACCCGGCGCAGTGTGGCGCAAGGCGTGACGCAATAGTCTTTTGGTAGTTTCAGCTTGGCACAAGAGTCGTTTTGAGGCGTTGTGCTACGCTGTTTAAATAGCAAATGCATTAGCGCTCATTTGTGC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5187
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059174 Nonsense 204 528 4 9
Genomic Location (Zv9):
Chromosome 3 (position 12546749)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 12568900
GRCz11 3 12720349
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATGAGAGACCGTTGTTTTGTTTTTTSRCAGGGAAACCCTTTGACACAACW[C/T]AGCCTGTGAACTACGCTGTGTCAAACATCATCTCGTCTATTGTGTACGGC
Long Flanking Sequence:
ATAACTCATTAAGAAAATAAACTCAACCCTTTTAGACCATGCACTGCGGCGCAAAGCAAGTTTTCCTGTCCTTAAATTAGAAAAAAACGCGTTCTGACACGCCCTGAAAGCGTTTGCGCCCTGCGCTTTGCGCTCTGCGCATGGACCGTCAAAATAGAGCCCAATGTGTGTCTAACTCATGTAGTCATCATTCTCTGCTCTTATTGTTGCTGAAACTAGTAGTGACATGGTTTTGTGTGGATCAGGAATCCTCTTTTCCAATGGAGAGAACTGGAAAGAGATGCGACGCTTCGCTCTCAGCAACCTGCGGGACTTTGGGATGGGCAAAAGAGGAAGTGAAGAGAAAATCATTGAAGAAATTCATCATCTCAAAGGAGAATTTGATAAGTTTGAAGGTGCTTGTTAAACAAGACACAAGTCTGCAATTCTGCTCTTAATTTTAAAGGTCCAATGAGAGACCGTTGTTTTGTTTTTTCGCAGGGAAACCCTTTGACACAACA[C/T]AGCCTGTGAACTACGCTGTGTCAAACATCATCTCGTCTATTGTGTACGGCAGCAGATTTGAATACATAGACCCTCGTTTCACAGAAATGGTTGCTAGAGCAAATGAAAATGTTCGAGTTGGTGGATCGTTTTCTATGATGGTAAGCATAATCTGCAAGTTAAGTAGAATTTGTACAGTGGGATCTTATTTTTAACAATGATATACTGCAGATTTATGTCTGTCTTTTGTCTCTAATTGTGCATTTTTAGATTTACAATATATTTCCCTGGTTGGGTCCATTTTTGAAAAATAGAGCAGTTGTTGTAAAGAACATCACTCAAAATAGAGCAGAAAAGAAAAAGTTGATCACTGCTCTTCTGGAGACTCTGAATCCACATGACCCCAGAGGGTTTGTCGACTCCTTTCTCATCCACAAACTGAGCGATGAGGTATGGAAATATGCAATGGTAGCTTTTAATGAAATAATCAAAAATTCTAGTTTGCAGTTTGCACAAACTCT
Associated Phenotype:
Not determined