Busch Lab

ZMP

CACNA2D1 (2 of 3)

Ensembl ID:
ENSDARG00000040406
Description:
calcium channel, voltage-dependent, alpha 2/delta subunit 1 [Source:HGNC Symbol;Acc:1399]
Human Orthologue:
CACNA2D1
Human Description:
calcium channel, voltage-dependent, alpha 2/delta subunit 1 [Source:HGNC Symbol;Acc:1399]
Mouse Orthologue:
Cacna2d1
Mouse Description:
calcium channel, voltage-dependent, alpha2/delta subunit 1 Gene [Source:MGI Symbol;Acc:MGI:88295]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa32189 Nonsense Mutation detected in F1 DNA Not yet available
sa36581 Nonsense Mutation detected in F1 DNA Not yet available
sa43055 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28986
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077152 Nonsense 102 515 5 19
Genomic Location (Zv9):
Chromosome 18 (position 9492766)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 10063405
GRCz11 18 9906721
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGTTTTCAGGGAATACTGCAAAGACCTCAAAGTATCATCTAACAATACT[C/T]AATTCCTGATGGACTTCAATGAATATATTAACAAGCAAACGCCAAATGAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28985
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077152 Nonsense 172 515 8 19
Genomic Location (Zv9):
Chromosome 18 (position 9484017)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 10054656
GRCz11 18 9915470
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGATCACTGAAATGATTTAATGTTTACAATGCTTCTTCCTCAGTGCTGGT[G/T]AGGAATGGGGTGAAAACTCCGAAACGTACGACTCGAGTTTCTACAAAAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32189
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077152 Nonsense 289 515 12 19
Genomic Location (Zv9):
Chromosome 18 (position 9477707)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 10048346
GRCz11 18 9921780
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGATTCTGGATGATGGAGGCTTTCTGCTCATGTCCAATCAGGAGGAATA[C/A]ATTCAGCAGGTAGGGTCAAGGGTGTAGATTTGGTTTTACACTAGTATATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36581
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077152 Nonsense 320 515 13 19
Genomic Location (Zv9):
Chromosome 18 (position 9474806)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 10045445
GRCz11 18 9924681
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGATGATCACTCTGGTCAACACATCGCTCTACTCCTTCAATAAAACCTA[C/A]GACTACCAGTCAGTCTGCGACCCTGAGAGAGAAACAAAAGCTGCCGCTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43055
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077152 Essential Splice Site 344 515 14 19
Genomic Location (Zv9):
Chromosome 18 (position 9474195)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 10044834
GRCz11 18 9925292
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTTGTGTCGAGTGACCCTGTTGCATCTGTGTTTGTATATTTGTTTTTGAC[A/T]GCCAACGATAGCAGATCTGCTTACCGTGGGCTGGTGGGCTTCTACTGCCG
Associated Phenotype:
Not determined