Busch Lab

ZMP

arhgef1

Ensembl ID:
ENSDARG00000040380
ZFIN ID:
ZDB-GENE-030722-5
Description:
rho guanine nucleotide exchange factor (GEF) 1 [Source:RefSeq peptide;Acc:NP_001075100]
Human Orthologue:
ARHGEF2
Human Description:
Rho/Rac guanine nucleotide exchange factor (GEF) 2 [Source:HGNC Symbol;Acc:682]
Mouse Orthologue:
Arhgef2
Mouse Description:
rho/rac guanine nucleotide exchange factor (GEF) 2 Gene [Source:MGI Symbol;Acc:MGI:103264]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa23467 Essential Splice Site Available for shipment Available now
sa44907 Nonsense Mutation detected in F1 DNA Not yet available
sa43243 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa16009 Nonsense Available for shipment Available now
sa23466 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa23467
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059102 Essential Splice Site 98 935 3 22
ENSDART00000114710 Essential Splice Site 312 1149 8 27
Genomic Location (Zv9):
Chromosome 19 (position 11569518)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 11161270
GRCz11 19 11079268
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACAACCGCTGCAGGGACACACTACCAAACTGTGTGAAAATGAAACAAAAG[G/A]TGGGATATTAGTGCACGCATGGGTCACGTGGAATACATGAACCACTGACA
Long Flanking Sequence:
TAGAATGCTCTAAAGAAGATTACTAATAAGAATTTTAACGCAGACATGGAGAGAGTTCAAGAGGGAGAGACAGATAGGAAAAAAACTGGTATGGTACATTTACTTCATTATTTAAAGTAATATACAATGTACAAATCTCAAAGGGAAAGTAGGAGATCTTCATATGTTTTTTTTTTTTTCATAGGAAATCAATTGTACGCTAAGCTAGTAGTTGTGATTGGCGACGTAGACTGGTTAGTTCAGACTGATAGATCCTCTTAGACCAAAACAAACCACTCATACAAGTCTATTATAGTCAAGAATGGCTTTAGTGGCATTTAATGACCAAATAGAACAAGCTGAGGTGTGTAAATGTGACCGTATGTAGATTATGCTATGTGACGACAATGTAAAATAACAAGATTGGTTCTGGTGTGTTCTTTTGTTTTTCAGCCTGTAACGTCACCATACACAACCGCTGCAGGGACACACTACCAAACTGTGTGAAAATGAAACAAAAG[G/A]TGGGATATTAGTGCACGCATGGGTCACGTGGAATACATGAACCACTGACATGCAGAAACATTTTACTTCATGGAATGATGATGGTATAGATTTAGATGTAATCTAAATATGTCATCTGTGTGTGTCACAACAGCAACAAAAAATGGCACTGATGAGGAACAATTCAGCCTATCAGAACGTAACACTGAGGAATAAAGGTGAGGATGGAGTAGAAATAAGTCAACTGTCTATTTATTTATGTCAATCCAATCAAAAGTGAGCAGTTGCGTGGGACAGATCTTATTGAGAAGACCATGTGACTTGTTCGTTGAGTGAAATAGATTTACTCTAGGTGTAAATTTAGTCCAAGTGTAAAAATGACATTGATCTCTCTTTTTCTACCTTTCTAAAGCCCATTTAAAGGAAAGGCCGAGTTCTGCCATCTACCCTTCAGACAGCCTTCGCCAGTCGCTACTCGGGTCCCGTCGTGGACGCTCTTCTCTTTTACTTTCAAAGAGCGT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29169
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059102 Essential Splice Site 200 935 6 22
ENSDART00000114710 Essential Splice Site 414 1149 11 27
Genomic Location (Zv9):
Chromosome 19 (position 11566704)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 11158456
GRCz11 19 11076454
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTCAACTTCAGGAGCAGAACCATGTCTATGGAGTCGCTCAATGATGAGGG[T/A]GAGACATGTGTACCTACAAACACATTATTTACTCACCCTCGTGTGTTCCA
Long Flanking Sequence:
CAATCCCCTACTTTATAAATACTGTAAACCAAACCATTGATGTGAAGTATCTGTACATTGACACTCAATTATTATCACTGTGTAATTTGTATTTTTTGTGTTTGTTTTTCTTGTTTGTGTGTTTGTGGCCTGTTTTAGTTTAATGTAAGCACTTTTGTTTGAATGTCATTGATTAGTCATCATGTTCACTGTATTTTGATTTCTATTAATTATCGTTAATGTATTTGATTTTGAATTAGCGTTTTCTGTTTCTGTGGTGATTATGATGCTTGCCTCTCATTTTGTTGTTTTGTTTTGTTTTCTTTTTTTTGGTGTCTTTGCATGGCATGCATACATGTACATCTGTTTGTGTGCATGCACTGTGTGTGTGTGCGTGCATCTGCGTGTAGGACTCTGAATGATGACTCTCCTCTGGGGCTGCGCAGGATTTTATCTCAATCCACAGACTCACTCAACTTCAGGAGCAGAACCATGTCTATGGAGTCGCTCAATGATGAGGG[T/A]GAGACATGTGTACCTACAAACACATTATTTACTCACCCTCGTGTGTTCCAAACATATAATAGGTTTGCTCATCTTTGAATACAAACTAAAACAATTTTAATGAGTTGTAAGAGATTTCTGTGCCTGAATAGATTTATATTTTTGTAAATAAATTCAAACAACTAATAATAATAATCAATATGAATCAATAAGTTCCCAGAGATGGGTTGTGGCTGGAAGGGTATCCACTGCGTAAAAAACGTGCTGGATAAGTTGGAGGTTCATTCTGCTGTGGCGACCCCGGATTAATAAAGGGACTAATCCGACAAGAAAATGAATTAATGAATAAGTTGAATCCAAGTATTTTGAATAGATACAATCACTTAATAAATCCAACAAATTTTCTTTAGGCTTTTTTTTCACAGATCTTTGAAGGAGTTATTTTTGTTCCAAAGACAAACTAAATTCTTTGAACTAAATGAAGATAGAATTTTTATTTGAAACAAACATTTTGATGTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44907
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059102 Nonsense 400 935 10 22
ENSDART00000114710 Nonsense 614 1149 15 27
Genomic Location (Zv9):
Chromosome 19 (position 11556772)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 11148524
GRCz11 19 11066522
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CACGGATTTCAGGAGTGTATCCTGCTGGTCACTCAGCGTATCACTAAATA[C/A]CCCGTCCTACTGCAGCGAATCCATGACAACACCAAAGGTGAGACTCACAT
Long Flanking Sequence:
TAGTATGTATTTTATCTGATATGTAGCCTAAATGTATTATCCAGGTGTTTTAAAAATTTGGCCTTGATTAAGATTTAATTTAATTTAATTTAATTTAATTTAATTTAATTTAATTTAATTTAATTTAATTTAATTTAATTTAATTTTAAATTTAAATTTAAATTTTAAGTTTAATTTTTTACAATAAGTTTCTATTTTAAGACACGTTAAAAAATAATAATGGCCAAAATTATCAATTATAATATTGTACATATTTTCGAGTAAAATTTTTGTTAATACATTTTTTTTTTATACCAGTACTAAATTAAAATGTATATGTATATGTTCATTTTTTTTTTTTTTTGTCACTTGGTTTTTGCCATAAGAGGCTATTTTTATGGCAAGATCAAATCCTTTCTTGTTGTCTCTGTCTCTGTTTAGAGGGTGAGTCGGGGGCCCTTACTGCGCCGTCACGGATTTCAGGAGTGTATCCTGCTGGTCACTCAGCGTATCACTAAATA[C/A]CCCGTCCTACTGCAGCGAATCCATGACAACACCAAAGGTGAGACTCACATGTATAATTGACGCCAGTGTCAATATTAGCTGTATTTAAATAGCTGCCCTTCTCCTCTGTGTATGCAATTCTGTAGCATTCTAATAAGTTAACAAAATTGATATGAAGCCAATGTAGTGTGTATATATATATAGTTGAAGGCAAAATTATTAGCCCTTTTTCAACTATTTTTTTTTCAACATATTTTAAATATAACAGTTTTAAAATGTACTAATTTCTTTTGTTTTTTGCCATGATAACAGTACACAATATGTGGCTAGTAATTTTGGAGTTTATTAGCATTGAGTTTTAAAGAGCAATGTAAAGGCTTAACCTGTTTAATTAGGTGAACTAGGCTAAGTTAGTGTGTAGCGGTATTTTGGCTAATAAAGTGGGTTGGGCGCTGGGGTTAAAAAAAAAAACAATACAGTTTCTCAAATAATTCAATTAAATAATAAATTAAGTTTCAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43243
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059102 Essential Splice Site 496 935 11 22
ENSDART00000114710 Essential Splice Site 710 1149 16 27
Genomic Location (Zv9):
Chromosome 19 (position 11553934)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 11145686
GRCz11 19 11063684
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATACATGAAGGCACGCTTCTCTGGAAAACACCCAGCTCTCGACTCAAAGG[T/C]ACTGAAGATGGTTGTACTGTATATAGGGACGTATGATGCGATACATATCT
Long Flanking Sequence:
TATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATTAATTACTGTCCAGTTTATTAAATAAACAAATCAAAGGACAAACAAATTTATAAATGCCCCTTTCAAGCACATATTGGTGACATCACGTTTTAGATTTTAATCATAAAATCACCTGCTTATAGATTTTATTGTATTTTTTTGTGATTGATTGTTATTTGTAAAATGCAGACAATCTGGAGGAAGCTGCAGGCCTGTCTCAGGCTCTGGCTTGTCTCCGCGAGCTGCTGTGTTCGGTGGATCAGCAGGTATTGGAGTTGGAGAGGACACATCGGCTGCAGGAGATCCGCTCTCGAGTGGACCCGCGTGCAGAGGCCAAACTTCGTTCCGGAGCTCTATTCCGACCGGCCGAACTGCTCCGCAGGCAGCTTATACATGAAGGCACGCTTCTCTGGAAAACACCCAGCTCTCGACTCAAAGG[T/C]ACTGAAGATGGTTGTACTGTATATAGGGACGTATGATGCGATACATATCTGTGTTAAGGCTGAGACACACCAAGCCAACGGTAGCATCAGATCGTCAGTGAGTGTCTGTCTGGCTACACTTTAAAAAGCAATTAGTTGACTTTACTTTAAAAAAGAGACTAAACTCGTTGCCTTATAATTATGAAGTAACCAAACTATTTACATAATTGTAAAAGTTAAGTCAATGGGTTTACTCAACCTAAAATTAACTTGTTGCTTTTAAGACAACGGCTTTATTCGGTTTTTAAAGTAATGTAACTAAACACTTTTTACAGTGTAGTTTGGTTAGGCTCATTTTAGAGGGAGTTTGTAGAAGCTATAGACCATCAGTGAGAGTGTCCTGATTGGGTGTTCATCTACGAATCAGAGCATGAGAGCGAAAACTAAAGTGATAGAGTTAAGCAATTGATGCAATTTAAGAGGGAACACAAAGAAGCATTTCTTAAAAGTGCTGTGTGTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16009
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059102 Nonsense 557 935 13 22
ENSDART00000114710 Nonsense 771 1149 18 27
Genomic Location (Zv9):
Chromosome 19 (position 11545578)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 11137330
GRCz11 19 11055328
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GAGCGAGGSTTGTTTCTGATCAGCAGTGAGTCCAGCCCACCTGAGATGTA[C/A]GAGCTCTATGCRGCRAGCAAAGATGACAGAAACACCTGGCTTCGCCTYAT
Long Flanking Sequence:
TCACATCTACATGTCTAACTATTCTCTCTTTGAAAGTGTCACCCTGCCTTAGACCCCTTTTGATTTCAAAGCCCTGCAATGGTATCTTAAAAAATTTGAGTTCTGAACAAGTACCAACGGTCTACACTATCGAAATCTTTTTAGGCTCCATAAATTTGGCATATTTTAAGCTCCATAAACCTCTGGATAAGGAAGAGTCGATCAGAATAGCGTAAGAATAGATACCATTCTTCTTACAGTTTACTTTCCGGACATGTCTTCAAATTTGTTTGCCCTTAGCATTGCATCCTAACAATTCCTAAAGGGGTTTGAATTTACTGATTGCATTTGGATGTTATCAGTATGCTAATGCACACAGATGGCAAATTTGTTCTGTTTGTGTCGTGTGTGTAGGACAAGTCTGCTGTAGTGTCACTGCAGAGTCTATTGGTTCGAGATATAGCCAATCAGGAGCGAGGGTTGTTTCTGATCAGCAGTGAGTCCAGCCCACCTGAGATGTA[C/A]GAGCTCTATGCGGCAAGCAAAGATGACAGAAACACCTGGCTTCGCCTTATACAGCAGACCATCGGCAGGTACAAACACATCTTTGTCTTTGCAGTGGAATTTGAAATTGCATTTCTTTTGAATTTGGATAATAAGCGGAAATATTTTGAAGGGATTTGTCAATCTGCTGGAAGCATTACTTGCCAAGTAGCCTGTGTTTGTTTTACAACTCAGCTAAAACTAATCTGACCCTAATACCATAGACATAGTTTAGACATAGTTTAGACAAAGTTTAGTTCCAACCCCAATCAGACACACCTGAGCTAGCTAATCAAGCTCATACTAGGCTTTCTAGAAACATTTATGCTGGTATGTTGAGCCAAGTTGGAGCTAAAATCTGCAGGACACCGGCCTTCCAGGACTGAGTTTGGACACCCCTGGCTCAGACCATGCTGGCAAAAAGTTATAGATCTTTCCAGTTGCTCTGTAGCTTGTTTGCCTTTCTTGTTTATGATGTGACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23466
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059102 Essential Splice Site 580 935 13 22
ENSDART00000114710 Essential Splice Site 794 1149 18 27
Genomic Location (Zv9):
Chromosome 19 (position 11545509)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 11137261
GRCz11 19 11055259
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAAGATGACAGAAACACCTGGCTTCGCCTTATACAGCAGACCATCGGCAG[G/A]TACAAACACATCTTTGTCTTTGCAGTGGAATTTGAAATTGCATTTCTTTT
Long Flanking Sequence:
AGCCCTGCAATGGTATCTTAAAAAATTTGAGTTCTGAACAAGTACCAACGGTCTACACTATCGAAATCTTTTTAGGCTCCATAAATTTGGCATATTTTAAGCTCCATAAACCTCTGGATAAGGAAGAGTCGATCAGAATAGCGTAAGAATAGATACCATTCTTCTTACAGTTTACTTTCCGGACATGTCTTCAAATTTGTTTGCCCTTAGCATTGCATCCTAACAATTCCTAAAGGGGTTTGAATTTACTGATTGCATTTGGATGTTATCAGTATGCTAATGCACACAGATGGCAAATTTGTTCTGTTTGTGTCGTGTGTGTAGGACAAGTCTGCTGTAGTGTCACTGCAGAGTCTATTGGTTCGAGATATAGCCAATCAGGAGCGAGGGTTGTTTCTGATCAGCAGTGAGTCCAGCCCACCTGAGATGTACGAGCTCTATGCGGCAAGCAAAGATGACAGAAACACCTGGCTTCGCCTTATACAGCAGACCATCGGCAG[G/A]TACAAACACATCTTTGTCTTTGCAGTGGAATTTGAAATTGCATTTCTTTTGAATTTGGATAATAAGCGGAAATATTTTGAAGGGATTTGTCAATCTGCTGGAAGCATTACTTGCCAAGTAGCCTGTGTTTGTTTTACAACTCAGCTAAAACTAATCTGACCCTAATACCATAGACATAGTTTAGACATAGTTTAGACAAAGTTTAGTTCCAACCCCAATCAGACACACCTGAGCTAGCTAATCAAGCTCATACTAGGCTTTCTAGAAACATTTATGCTGGTATGTTGAGCCAAGTTGGAGCTAAAATCTGCAGGACACCGGCCTTCCAGGACTGAGTTTGGACACCCCTGGCTCAGACCATGCTGGCAAAAAGTTATAGATCTTTCCAGTTGCTCTGTAGCTTGTTTGCCTTTCTTGTTTATGATGTGACCTCTGGGCTGCTTGGCCCTGATAATTGCTGCTTGCAGCTATATTTATCAGTATTATTAATACATTACAAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29168
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059102 Essential Splice Site 850 935 20 22
ENSDART00000114710 Essential Splice Site 1064 1149 25 27
Genomic Location (Zv9):
Chromosome 19 (position 11535897)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 11127649
GRCz11 19 11045647
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGACTAATAGCGCCGCTCTAGGGGATCGAGGTGGTACTGCAGGCTCACAG[G/T]TCAGTTGGTTTTAGACCTTTGTTCTCATTGTGTATTTTTGTTATATCATC
Long Flanking Sequence:
GATTATGTATGCACTGATATGTGATGCGTCTGAATGTCTTGTGTTTCAGGAGGTGTCACAGAGGCTGGTGAATCTCAGTGCTCAGTTACACGCTCTTCAGGTATGAAAATAACACGTCAAATCAAAACACGCCGCAAAATCAACTGTGAATATCAATAAAAAGGCTAAAACAAAACCCACTTTTCTAGGGTGTGGTGATACGACAGGACACCATCTTAGAGCTCTGTCTACGAGAGAGCCCCGTCTCCCAGACCCCCTCAGGAGCTCGCACTGTACGCTCTCTTTCCCGGGACGGAGCCAGTGACATGGGCTCAGTGGGTGAACTGGCCCTGCTTCAGCGGCAGCACAGCCTCCTGCAGGAGGAGCTGGTGCGCCTCAGAGGAGCCGACGGCAAACTCAGGGACAGCGAGAGAGTCAGAGCTCATCTGGAGAAACAGCTCAGGGATATGAAGACTAATAGCGCCGCTCTAGGGGATCGAGGTGGTACTGCAGGCTCACAG[G/T]TCAGTTGGTTTTAGACCTTTGTTCTCATTGTGTATTTTTGTTATATCATCCTTTGATGCATGCAAATCTACATTTTTCCCGGAGAGTGTACAGAAGGGTGACTTTTTTCAATCAGCATCTAATCAATGTCCTTTATAGATGCCATGTGGTCTTTACAGGGCAGAAGCTTCCTATTTTAATTCACTTCTAAATTCATTTACTCTCTTCAAGGCTCCGTCAAATCGAAGAGAGAGCGATACTGACCCCAACACTGACACGCCACTGGCCAGCCAGGAATCCATGGACCAATCGGACGGCCTGCAGGAGTGCAGCGATGTGGAAGTGGATGTGATTTCGGATGATGATGACGACGACGAAGTGGATTCAAGGGTTTCTCCCCGTTCAGAAAGTCCCAGAGGTCGGTATTTTAAGAGACAGAAATATATGAGACGGACTATTTTTTTGTGTCCGCATCAAATAATTCAGTTTACAAAAGTTGTTTTTCTACATAGAAAGCGTAT
Associated Phenotype:
Not determined