Busch Lab

ZMP

ephb4a

Ensembl ID:
ENSDARG00000040346
ZFIN ID:
ZDB-GENE-990415-62
Description:
eph receptor B4a [Source:RefSeq peptide;Acc:NP_571489]
Human Orthologue:
EPHB4
Human Description:
EPH receptor B4 [Source:HGNC Symbol;Acc:3395]
Mouse Orthologue:
Ephb4
Mouse Description:
Eph receptor B4 Gene [Source:MGI Symbol;Acc:MGI:104757]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa11431 Nonsense Available for shipment Available now
hu3445 Nonsense Available for shipment Available now
sa13275 Nonsense Available for shipment Available now
sa33770 Nonsense Mutation detected in F1 DNA Not yet available
sa30869 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa11431
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059042 Nonsense 67 989 3 18
ENSDART00000121947 Nonsense 67 987 3 17
ENSDART00000133074 Nonsense 40 960 2 16

The following transcripts of ENSDARG00000040346 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 70810152)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 67698590
GRCz11 5 68453888
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGGGAGGAGGTCAGTGGTCTGGRTGAGGAGAACAACAGTGTGCGGACCTA[T/A]CAGATCTGCCAGGCGGACGGCTCCAGCAGTCATTGGCTGCGYAGTAAGCT
Long Flanking Sequence:
ATGAAGTATTTAAAGTACACATGAAATCAAAACTAAGCCTGTTGATTTGATTAGCTCACAGCGCTAGCTTTGTGGTGAACAATTCATCTGTGTAGGGCATTAAGACAAAAAAAATAGTTTGTCCTTGTAATCTTTAATCAAAATCTGTAAATGCACTTCCTGTTTGTTTTTTGTGATCACACCTATCTGAGGTATTGGGCGTGGCTAACATACTTAACCACGCCCCTCCAGCTGTCACTTTTGACAACAAACAGAAATGGTGAAGAGGAGGAGGAGGAGTCTGTTAGGCTATAATAACTCTCTCAAAAAATCCTTTTCCAATCACCTCGCAGTAGAAAAAAACAAGCCCCGCCCACTCATGTATGATTCAGTTTCTCTAGGAATAAGTAAAAAATAAATAAATAAAAGTCGCAGCTTCTGGACTTTAAGTGATTTTTGTGTGTTTTGCAGTGGGAGGAGGTCAGTGGTCTGGATGAGGAGAACAACAGTGTGCGGACCTA[T/A]CAGATCTGCCAGGCGGACGGCTCCAGCAGTCATTGGCTGCGTAGTAAGCTGATCGAGCGGCGGGGGGCGTCACAGGTGTACGTGGAGCTGTTCTTCACTATGGTTGAGTGTTCATCTCGAAACACACACCACCGCTCCTGCAAAGAGACTTTCAACCTTTATTACTACCAAAGCGACACGGATGACGCCACAGCCACCCACCCGGCGTGGATGGAGAACCCCTACACCAAGGTGAACACATACTGATGAATATACACTAGTCTGCATGCACATTTGGAGTACATGTGAAGTTCCCACTTTTGTATTAACCACTACAGTGGGGGAAATAAGTATTGAACACGTCACCGTTTTTTTTTTTGTTCAGAAAACATATTTCTTAAGATGATGTTAACTTGAAATTGTCACAAAAAAGTCCATATATGTAACATAAACTAAACTAATTAGTTCCTAAACAAAGTTGAAATGATGCAGGGAAAAAAAGTATTGAACACATGAAGAAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26627
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059042 Nonsense 86 989 3 18
ENSDART00000121947 Nonsense 86 987 3 17
ENSDART00000133074 Nonsense 59 960 2 16

The following transcripts of ENSDARG00000040346 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 70810207)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 67698535
GRCz11 5 68453833
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTGCCAGGCGGACGGCTCCAGCAGTCATTGGCTGCGTAGTAAGCTGATC[G/T]AGCGGCGGGGGGCGTCACAGGTGTACGTGGAGCTGTTCTTCACTATGGTT
Long Flanking Sequence:
TCACAGCGCTAGCTTTGTGGTGAACAATTCATCTGTGTAGGGCATTAAGACAAAAAAAATAGTTTGTCCTTGTAATCTTTAATCAAAATCTGTAAATGCACTTCCTGTTTGTTTTTTGTGATCACACCTATCTGAGGTATTGGGCGTGGCTAACATACTTAACCACGCCCCTCCAGCTGTCACTTTTGACAACAAACAGAAATGGTGAAGAGGAGGAGGAGGAGTCTGTTAGGCTATAATAACTCTCTCAAAAAATCCTTTTCCAATCACCTCGCAGTAGAAAAAAACAAGCCCCGCCCACTCATGTATGATTCAGTTTCTCTAGGAATAAGTAAAAAATAAATAAATAAAAGTCGCAGCTTCTGGACTTTAAGTGATTTTTGTGTGTTTTGCAGTGGGAGGAGGTCAGTGGTCTGGATGAGGAGAACAACAGTGTGCGGACCTATCAGATCTGCCAGGCGGACGGCTCCAGCAGTCATTGGCTGCGTAGTAAGCTGATC[G/T]AGCGGCGGGGGGCGTCACAGGTGTACGTGGAGCTGTTCTTCACTATGGTTGAGTGTTCATCTCGAAACACACACCACCGCTCCTGCAAAGAGACTTTCAACCTTTATTACTACCAAAGCGACACGGATGACGCCACAGCCACCCACCCGGCGTGGATGGAGAACCCCTACACCAAGGTGAACACATACTGATGAATATACACTAGTCTGCATGCACATTTGGAGTACATGTGAAGTTCCCACTTTTGTATTAACCACTACAGTGGGGGAAATAAGTATTGAACACGTCACCGTTTTTTTTTTTGTTCAGAAAACATATTTCTTAAGATGATGTTAACTTGAAATTGTCACAAAAAAGTCCATATATGTAACATAAACTAAACTAATTAGTTCCTAAACAAAGTTGAAATGATGCAGGGAAAAAAAGTATTGAACACATGAAGAAAGGGAGGTGTAGAAATGCAGTGAAAGCCCAGACAGCAGCTGAAATCTCCCAGTAGT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
hu3378
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059042 Nonsense 238 989 4 18
ENSDART00000121947 Nonsense 238 987 4 17
ENSDART00000133074 Nonsense 211 960 3 16

The following transcripts of ENSDARG00000040346 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 70813946)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 67694796
GRCz11 5 68450094
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGGCAGTGGGCCAGTGTGTGGCCAACGCAGCACAGCCTGGCCCCAGTCCC[A/T]GACCGCCCAAGATGTTCTGCGGAGAAGATGGACAGTGGGTGGACCAGCCC
Long Flanking Sequence:
CACAGAGGAACATTTACACCTCACTGCCAACTAGTGTTTCGGAAGTGTTAATGCAGACCAACAGAAACAGCGCGCAGAAGTATAAATGCACAGCTACGCGCGTTGCATGCACCGTGGGTTACGCCGGTCACTTGACGCAGAAGTATAAACCAGGCTTAAGTGTGAACTCTTTTAGCACACCTTTAGGATGATCAATATATAATTGTGTTTTTATTCTCCAGGTGGACACAGTGGCCGCAGACTTCCTACTGCGCAAAGGCGGAGAGAAGAAAGTCAACGTGAAGACGCTGCGTTTGGGCCCGTTGAGCAAGCGTGGATTCTACCTGGCGTTTCAGGCTCAGGGCGCGTGCATGGCTCTGCTCTCCGTGCGTGTTTTCTTCAAGAAGTGTCCGGCGCTCACGCGCTCACTATCCGTCTTCCCGGAGACCGTTCCCCGCTCGCTGGTCCAGGAGGCAGTGGGCCAGTGTGTGGCCAACGCAGCACAGCCTGGCCCCAGTCCC[A/T]GACCGCCCAAGATGTTCTGCGGAGAAGATGGACAGTGGGTGGACCAGCCCACCACCACCTGCACTTGCCTGCCGGGCTTCGAGGCCAGCCATGGAGAGCTGGAGTGTAGAGGTGAGCGAGAGCAAACACAACAGACTGAAGAGCAAGCTAATTTAAGATTGGAAATATAAGCAAATAAAATCAAGCTGAGGTTTTCTGGATTCTGAGGAAAACTGCTAAATAAACCTTTGGCAATGCAGGTAACAAGTGTTGAGGAAGTTACTTTTAAAAAGTAATAGATTGCAAATGACTGATTACTACTGGAAAATTGTAATCGGATTACTTTACTAGTCATTCAAAAAGTAATCAGATTACTAATTGCTTGTTACTTTTAGTTTAACTCTGTTTTTTATTGAAATCTGTTCGTCAGAGAGCCACAGCATCAGATACACAGAATCATTAGACATCAACTGCTCCAGTGTGGTGGTAGAATACAATTTTGCTCACGTTTTCTTTCTCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
hu3445
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059042 Nonsense 245 989 4 18
ENSDART00000121947 Nonsense 245 987 4 17
ENSDART00000133074 Nonsense 218 960 3 16

The following transcripts of ENSDARG00000040346 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 70813967)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 67694775
GRCz11 5 68450073
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCAACGCAGCACAGCCTGGCCCCAGTCCCAGACCGCCCAAGATGTTCTGC[G/T]GAGAAGATGGACAGTGGGTGGACCAGCCCACCACCACCTGCACTTGCCTG
Long Flanking Sequence:
CACTGCCAACTAGTGTTTCGGAAGTGTTAATGCAGACCAACAGAAACAGCGCGCAGAAGTATAAATGCACAGCTACGCGCGTTGCATGCACCGTGGGTTACGCCGGTCACTTGACGCAGAAGTATAAACCAGGCTTAAGTGTGAACTCTTTTAGCACACCTTTAGGATGATCAATATATAATTGTGTTTTTATTCTCCAGGTGGACACAGTGGCCGCAGACTTCCTACTGCGCAAAGGCGGAGAGAAGAAAGTCAACGTGAAGACGCTGCGTTTGGGCCCGTTGAGCAAGCGTGGATTCTACCTGGCGTTTCAGGCTCAGGGCGCGTGCATGGCTCTGCTCTCCGTGCGTGTTTTCTTCAAGAAGTGTCCGGCGCTCACGCGCTCACTATCCGTCTTCCCGGAGACCGTTCCCCGCTCGCTGGTCCAGGAGGCAGTGGGCCAGTGTGTGGCCAACGCAGCACAGCCTGGCCCCAGTCCCAGACCGCCCAAGATGTTCTGC[G/T]GAGAAGATGGACAGTGGGTGGACCAGCCCACCACCACCTGCACTTGCCTGCCGGGCTTCGAGGCCAGCCATGGAGAGCTGGAGTGTAGAGGTGAGCGAGAGCAAACACAACAGACTGAAGAGCAAGCTAATTTAAGATTGGAAATATAAGCAAATAAAATCAAGCTGAGGTTTTCTGGATTCTGAGGAAAACTGCTAAATAAACCTTTGGCAATGCAGGTAACAAGTGTTGAGGAAGTTACTTTTAAAAAGTAATAGATTGCAAATGACTGATTACTACTGGAAAATTGTAATCGGATTACTTTACTAGTCATTCAAAAAGTAATCAGATTACTAATTGCTTGTTACTTTTAGTTTAACTCTGTTTTTTATTGAAATCTGTTCGTCAGAGAGCCACAGCATCAGATACACAGAATCATTAGACATCAACTGCTCCAGTGTGGTGGTAGAATACAATTTTGCTCACGTTTTCTTTCTCTCTGAATAAAACAATAATTACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13275
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059042 Nonsense 362 989 6 18
ENSDART00000121947 Nonsense 362 987 6 17
ENSDART00000133074 Nonsense 335 960 5 16

The following transcripts of ENSDARG00000040346 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 70830557)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 67678185
GRCz11 5 68433483
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTGGAGTGGAGYGAGCCRTTGGACAGCGGCGGCCRYTCGGATCTCAGCTA[C/A]AGSGTGGAGTGTAGGATGTGCTCCACCCCTGGAAGTCCCTGCACACTATG
Long Flanking Sequence:
CAAGACACTTCTATACAGCTTAAAGTGACATTTAAAGGCTTAAACTAGGTTAATTAGGTTAAGTTAGAGTTATTAGGCAAGTCATTGTATAACAGTGGTTTGTTCTGTAGACAATCGTAAAAACAATAAAGCTTAAGCGGTTAATAATATTGACCTTAAAATGGTTTTAAATAAATTAAAAACTGATTTAATTCCAGACGAAATAAAACAAATAAGACTTTCTCCAGAAGAAAAAATATTAAAGGAATACTGCGAAAAATTTCTTGCTCTGCTAAACATCATTTGGGAAATATTTAAAAAAGAAAACTCACAGGAGGGTGAATAATTCTGAGGTCAACTATGATGGACAATGGAGTGTTACAGATGCATGAAGTGTTTTTGTTATTGTGTTCAGGTCCTCCGTCGTCTCCGCGCAGCCCCGTCCCGCAAGTAAACGACACATCTCTGACTCTGGAGTGGAGCGAGCCGTTGGACAGCGGCGGCCGCTCGGATCTCAGCTA[C/A]AGCGTGGAGTGTAGGATGTGCTCCACCCCTGGAAGTCCCTGCACACTATGCAGTGACGGTGTGAATTATCGGCCGTCCCAAACAGGGATCCAAGGCCGGCGCGTGAGCATTTGGGGTCTGAGACCTCACACCACCTACAGCTTCACTGTCATGGCCCTCAACGGGGTCTCCGCTCAGAGTCAGCAGGGGCCTGCAGGAGAGACCATCAACATCACCACCAGTCCCAATGGTGAGAATGAGAAACAGCAGGTTTTATACCACAATACTTCTTTAGTATGGTGTAGGGCCTCCTTATTCGGCCAACACAGCATCAGTTGGTCTTGGGAATGACAGATACAGGATGTTGAGCCATTCTTCTTGCAGAGTAGTGGCCAGGTCACTGCGTGATGCTGTTGGAGGAAAACATTTCCTAACTCGCTCCTCCAAAACACCCCAAAGTGCTTAATAATGTTTAGATCTGGTGACTGTGCAGGCCATATGAGATGTTCAACTTCATATTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33770
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059042 Nonsense 515 989 8 18
ENSDART00000121947 Nonsense 515 987 8 17
ENSDART00000133074 Nonsense 488 960 7 16

The following transcripts of ENSDARG00000040346 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 70832589)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 67676153
GRCz11 5 68431451
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGGTGGTTTTGAGCGACTTGCGAAGGGCCACGCAGTATGAGGTTCAAGTC[C/T]GAGCTCGGACATTCGCCGGATATGGAAGCTTTGGTAAAGCCATCCTCTTT
Long Flanking Sequence:
TAATGTAATGCTAATTTATTTCAACTGTACTACATTTGCTCAAATAAACATTCAATCAAGTATCAAAATATGCATTATGTTCACTCATACCTATATTTTTTGAGTATTAAAGTGACTTTTGCTTACATTCAGGACATATCCCATTTGATCAGTGCATAAAACCACCCAGGATTTACTCAGGATAATGTGTTTTCTCCTCAGTGTAGTTCACTGTGTTTTTATACCTCCATTGTTTTTATGAGCTCTCCCTATATCTCTTGCTCCAGTTTTCTCATGCTTGTGTTTTATCGATCTCTCTCTCTCTGTGCACTGTTTACACTGCAAACATGCCAGACTAATTAACAATTAATACATTGAAACGCCTCAGAGAAGTTATTGAAGATGTTTTCTCGTGACAGGAGCGCGGATCTGAAGAAAACTCCTGTCATTATATGGAGAGCAATAACAACGAGGTGGTTTTGAGCGACTTGCGAAGGGCCACGCAGTATGAGGTTCAAGTC[C/T]GAGCTCGGACATTCGCCGGATATGGAAGCTTTGGTAAAGCCATCCTCTTTCGAACTCTACCTGACGGTAAGACATTTATACAAGGTAATGGAATTTCTGGAATATAAAGTGTCTATTTCAGACTAGGCATGGGATGATAACTGGTATCAAGGTTTAGCGCGGTTTGGTAAAAGTCAAGGTTTTAAAATCGCCAAAATGTTCTGTTAGACTATTTCTACCGTGTTTTTACAAGTGTTTTATTAAGTTTTTAGGGCAACAGTAGCTCCAGCTGAAAGGCACCCTCCATATCAAAAGCTACTGGTAATCTCATGATATAGGAAACACCTAGAAAACATATCACTAATACACCGTACAACCATCGTTAGCCAACTAAAATCTCCTACACACCGGGACGCTTTTCGTTTGCGTTAACCGTCAGCGTTTTACGAGACATTTTTCAGTATTCAAACACAATCGCTTTTCACAGGCGTCAAGCTGAAGAGTATGCAAAATCACTCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30869
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059042 Nonsense 863 989 15 18
ENSDART00000121947 Nonsense 863 987 15 17
ENSDART00000133074 Nonsense 836 960 14 16

The following transcripts of ENSDARG00000040346 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 70851664)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 67657078
GRCz11 5 68412376
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCGCCGCCGGACTGTCCCACATACTTGCACCAGCTGATGCTGGACTGCTG[G/A]CAGAAGGAGAGGACGGCCCGGCCACGCTTCGCCAACATCGTCTCAGCTCT
Long Flanking Sequence:
CTCCCTCCAACTTTGCTTCGTATCTAATTTCTGTGCTATCGTAATAAAGTCAAAATCAGAAAAATTATGTTAAAAATGTTGCAGTAAGTTCATTTCTTTGAAAGAATGAAATAGCTTTTTAAGTAAGGATCCATTAAATTGATCAAAAATAATAAATGTCCAATTTTTAATAAATTTTCTTCATTTAAAACACAAAAGAAATGAGTTCTTAAAACTATTATGTTTAAAAATATGTCGGAAAAAAATCTACACTCCGTTAAACAGCATTTAGGGAATATTTTGAAAAAGAATACAATTGACAGGCGCTCTTCAGCTGTATGTATTTTGGCTAATACATCCTAGGTAATATTGATCTGATGTATTGAGTTTGTTCCTCCTGTCATCAACATAGTGTATTGTGTTTGACCCAATCAGGTGATTAATGCCATTGAGCAGGATTACCGTCTGCCACCGCCGCCGGACTGTCCCACATACTTGCACCAGCTGATGCTGGACTGCTG[G/A]CAGAAGGAGAGGACGGCCCGGCCACGCTTCGCCAACATCGTCTCAGCTCTGGACAAGCTGATCCGCAACCCGGCCTCACTCAAAATCACAGCGCAGGAGGGGGCGGGGTGAGACTCTGATCCACAACACTTCTACATCACTCAATGCCGCAGCGAGCGCAGATTGAGAACAACACTAAGCAAATACATCTAGTTTATTACGTTTTGTCTTCTTCTTTTATCTCATTCAATTTTGATTCCGTTTTATTTAGTTTTTGTCTTGTTTTGTTTTTTGTTCATTTTAATTAGTTTTTGTGTTTTGTTGTTTTATTTTGTTTAGTTTTGTCTTATTTCAGTTGTTTTTGTTTTTTGTTATGTTTTTTGTTAGTTTTCATTTTATTTAATTTTTGTTTTATTTTGGTCTTGTTTCGTTGTTTTATTTTTGTTTTTATTTTGTTTTTGTCTTGTTTTGTTTTGTTTTTGTCTCATTTTGTTTCCGTTTCATTTTGTTTTTGTCTTGTT
Associated Phenotype:
Not determined