Busch Lab

ZMP

Q568U1_DANRE

Ensembl ID:
ENSDARG00000040326
Description:
LOC553505 protein [Source:UniProtKB/TrEMBL;Acc:Q568U1]
Human Orthologue:
DHX29
Human Description:
DEAH (Asp-Glu-Ala-His) box polypeptide 29 [Source:HGNC Symbol;Acc:15815]
Mouse Orthologue:
Dhx29
Mouse Description:
DEAH (Asp-Glu-Ala-His) box polypeptide 29 Gene [Source:MGI Symbol;Acc:MGI:2145374]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa15603 Nonsense Available for shipment Available now
sa21657 Nonsense Available for shipment Available now
sa34841 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa15603
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123923 None None 307 None 9
ENSDART00000129467 Nonsense 439 1381 10 27
Genomic Location (Zv9):
Chromosome 10 (position 7211556)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 8229802
GRCz11 10 8188502
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATGTTTTGGAGGTTTGTCCCACTATCCTGACTGAAGACGGCATGCAGGCY[C/T]AGCATTTAGGAGCCACRCTAGCACTTTATAACCTAGTCAAAGGRMAGGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21657
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123923 None None 307 None 9
ENSDART00000129467 Nonsense 490 1381 11 27
Genomic Location (Zv9):
Chromosome 10 (position 7208155)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 8226401
GRCz11 10 8185101
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACGGCGAACAAAAAGAAGAGGAACAAACTCTTTTGGCCATCAACAAACCC[C/T]GAGACCAGTTCATCTCACGTCTGCTCACTCGCCTCAAACAGCAGCAGAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34841
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123923 None None 307 None 9
ENSDART00000129467 Essential Splice Site 1288 1381 24 27
Genomic Location (Zv9):
Chromosome 10 (position 7183820)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 8202066
GRCz11 10 8160766
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGTAAACCGTTTCCTGCAAACCCATGGCTGGATGCTTTTCCAGGAAAAAG[T/A]GAGCCAGGCTGTTTTTAATATGTTACTGGGACATGCTGTGGGGGGTTTTA
Associated Phenotype:
Not determined