Busch Lab

ZMP

gtpbp10

Ensembl ID:
ENSDARG00000040300
ZFIN ID:
ZDB-GENE-040718-153
Description:
GTP-binding protein 10 [Source:UniProtKB/Swiss-Prot;Acc:Q6DHF7]
Human Orthologue:
GTPBP10
Human Description:
GTP-binding protein 10 (putative) [Source:HGNC Symbol;Acc:25106]
Mouse Orthologue:
Gtpbp10
Mouse Description:
GTP-binding protein 10 (putative) Gene [Source:MGI Symbol;Acc:MGI:2385599]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa45574 Nonsense Mutation detected in F1 DNA Not yet available
sa36116 Nonsense Mutation detected in F1 DNA Not yet available
sa36117 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa45574
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058970 Nonsense 8 380 1 10
ENSDART00000122581 Nonsense 8 380 1 11
Genomic Location (Zv9):
Chromosome 16 (position 26130863)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 23976538
GRCz11 16 23891570
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCTTTTCTTTCAAGAGTTGTTTTGGGATGGTGTGGACAAGCAGAATTTG[T/A]TTCCGGAAGGTTAGTAACGTCGACCAGCTCGTCGAATTGGATTTAATGCT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4657
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058970 Nonsense 22 380 2 10
ENSDART00000122581 Nonsense 22 380 2 11
Genomic Location (Zv9):
Chromosome 16 (position 26131874)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 23977549
GRCz11 16 23892581
KASP Assay ID:
554-3595.1 (used for ordering genotyping assays)
KASP Sequence:
TGTCNTTTTTTATTTCAGTATGGCAATTTTGTGGATAATGTACGGCTGTA[T/A]GTTAGAGGTGGTACTGGAGGAATGGGTTTGCCCCGTTTAGGTGGACATGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36116
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058970 Nonsense 264 380 9 10
ENSDART00000122581 Nonsense 264 380 9 11
Genomic Location (Zv9):
Chromosome 16 (position 26140115)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 23985790
GRCz11 16 23900822
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCTGTATACTTCCTCATGGCCTTCTTTGTTAAACAGGAGCTGGAGTTGTA[C/A]AAGGAGGAGCTGTTAAGCAAGCCTGCTATCTTGGTCATAAATAAAATGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36117
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058970 Nonsense 342 380 10 10
ENSDART00000122581 Nonsense 342 380 10 11
Genomic Location (Zv9):
Chromosome 16 (position 26140718)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 23986393
GRCz11 16 23901425
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCCATGACTGGTCATGGACTGCCCTTGCTCAAGTCCCTGATCCGGCAGT[C/A]GCTTGAGGAGCAGGACACCATAGACACTGAGGCTCAGCGCAGTCAGAAGA
Associated Phenotype:
Not determined