Busch Lab

ZMP

apoa4

Ensembl ID:
ENSDARG00000040298
ZFIN ID:
ZDB-GENE-030131-1263
Description:
apolipoprotein A-IV [Source:RefSeq peptide;Acc:NP_001073330]
Human Orthologues:
APOA1, APOA4, APOA5
Human Descriptions:
apolipoprotein A-I [Source:HGNC Symbol;Acc:600]
apolipoprotein A-IV [Source:HGNC Symbol;Acc:602]
apolipoprotein A-V [Source:HGNC Symbol;Acc:17288]
Mouse Orthologues:
Apoa1, Apoa4, Apoa5
Mouse Descriptions:
apolipoprotein A-I Gene [Source:MGI Symbol;Acc:MGI:88049]
apolipoprotein A-IV Gene [Source:MGI Symbol;Acc:MGI:88051]
apolipoprotein A-V Gene [Source:MGI Symbol;Acc:MGI:1913363]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa36119 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4658
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011669 Nonsense 83 239 3 3
ENSDART00000126607 Nonsense 81 368 3 6
ENSDART00000129525 Nonsense 83 255 4 4

The following transcripts of ENSDARG00000040298 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 26154377)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 24000052
GRCz11 16 23915084
KASP Assay ID:
2260-9641.1 (used for ordering genotyping assays)
KASP Sequence:
GACTGACCCAGAGTGCTGATATGGCCAGTGAATACGCCGTCACCCTCAAG[A/T]AACAGGTGGATCCTCTGACTGAAGAGCTGATGAACAAAATCACCAAGGAG
Long Flanking Sequence:
GAGGAGAATGTCTGTTGGTGGAGCAGTGTCAACAGTTATTAAGCAGTCAGCTAATAGTCTAATGAGAATTGCAGTTATTGGTGCACTTTCTTCTCGGGTTCAGCGGTTGTATAGTGGTTATATATATAAAAAAACTCACTTGAATGTTTATAATTGGTGCAGATTTGGAAATTGATTGGGGAACATAGATTTAATTATTTGTATTTTTTACCAGGCTGCCAGGCCAACCTATTCTATGCTGATGAGCCCAAACCACAGCTGGAGCAGCTGACAGATGCATTCTGGAGCTATGTTTCCAAAGCAACACAAACTGCAGAGGAAACCGTCAAGATGATCAGAGAGTCTCAACTGGGTCAAGAAGTCAAGTGAGTCAAAATCTTCCTGCTGGACATCATTATTTAGAGTATTTCTGTATGAAACTCAAATGTTCTTCTTTACCTCACAGTGAAAGACTGACCCAGAGTGCTGATATGGCCAGTGAATACGCCGTCACCCTCAAG[A/T]AACAGGTGGATCCTCTGACTGAAGAGCTGATGAACAAAATCACCAAGGAGACTGAAGTGCTGAGGGAGCGTCTGGGGCAGGACCTGATCAATGTGAGAGAGAAACTCGAGCCCTATGCTGACAACATGAAGAGCCAGATCCAGCAGAGAGTGGAGGAGCTCAGGGCGGCCATGGCTCCGTATGCTGACTCCCTGGATTCTGAAACCCTGAAGGCCACTCTTCTCCAGAAGAGTGAGGAGCTGAGAGGAAACCTGGAGCAGAGTGTGAAGGAGCTGCAGGCTCAGCTGGAGCCCTACACTGCTGAACTCAAGGAGAAAGTGGACCAGCATCTGCAGGAGTTCCAGAAAACTGTGAGTCCTCTAGCTGAGGATCTGCAGGTCCAGATTAGAGAGAGAGCCCAGATTGTCCAGCAGAGTCTTACACCCTATGCTGAAGACCTTAAGGAGAAGCTGGACCCCTATGCACAAAACCTAAAAGACCAGCTGATCTCTCTGTACGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36119
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011669 None None 239 None 3
ENSDART00000126607 Nonsense 360 368 5 6
ENSDART00000129525 None None 255 None 4

The following transcripts of ENSDARG00000040298 do not overlap with this mutation:

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 26162010)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 24007685
GRCz11 16 23922717
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAGCTGGACCCCTATGCACAGAACTTGAAGGACCAGCTCGCTTCTCTGTA[T/G]GACTCTTTCATCAAGAGAAATTAAATGCATTAAAGACTTCTCTTTTTTAC
Long Flanking Sequence:
AAGAAACAGGTGGATCCTCTGACTGAAGAGCTGATGAACAAAATCACCAAGGAGACTGAAGTGCTGAGGGAGCGTCTGGGCCAGGACCTGATCAATGTGAGAGATAAACTCGAGCCCTATGCTGACAACATGAAGAGCCAGATCCAGCAGAGAGTGGAGGAGCTCAGGGCGGCCATGGCTCCGTATGCTGACTCCCTGGATTCTGAGACCCTGAAGGCCACTCTGCTCCAGAAGAGTGAGGAGCTGAGAGGAAACCTGGAGCAGAGTGTGAAGGAGCTGCAGGTTCAGCTGGAGCCCTACACTGCTGAACTCAAGGAGAAAGTGGACCAGCATCTGCAGGAGTTCCAGAAGACCGTGACTCCCCTGACCGAGGATCTGCAGGTCCAGATTAGAGAGAGAGCCCAGATGGTCCAGCAGAGTCTTACACCCTATGCTGAAGATGTGAAGGAGAAGCTGGACCCCTATGCACAGAACTTGAAGGACCAGCTCGCTTCTCTGTA[T/G]GACTCTTTCATCAAGAGAAATTAAATGCATTAAAGACTTCTCTTTTTTACCAAATTAACTCTTCACAAACTTCGAAATTTGACATATTTGATCCATGTTTTTTTCTATCGATTCATCCTATCATGCCATAAATTAAGTCTAGTTTCCTAACTGTGCAATATTCAATGTCCTTTACATTTGCAAATGTTCTGTTTTAATGTGTGGTGCTGGATATTTATTTAATAAAATATCAAATATTTTTCAGACAAAATGTTTGTGATGTTTACAAATGCCACACATTTGACCATAACTATCAATCATTCATTCATTCATTTCCTTTTTGGCTTAGTCCTTTTATTAATCTGGGGTCGCGAAAGGAGAATGAACTGCTAACTTCAGCATATGATTTACGCCGCGGATGCCCTTTCAGCTGCAACACATCACTGTGAAACACCCATACACTCCCATTCACTACGAACAATTAACCAACCCAATTCACCTATACCACGTCTTTGGATTTG
Associated Phenotype:
Not determined