Busch Lab

ZMP

zgc:112374

Ensembl ID:
ENSDARG00000040290
ZFIN IDs:
ZDB-GENE-050522-353, ZDB-GENE-071004-70
Description:
hypothetical protein LOC568655 [Source:RefSeq peptide;Acc:NP_001098592]
Human Orthologues:
PON1, PON2, PON3
Human Descriptions:
paraoxonase 1 [Source:HGNC Symbol;Acc:9204]
paraoxonase 2 [Source:HGNC Symbol;Acc:9205]
paraoxonase 3 [Source:HGNC Symbol;Acc:9206]
Mouse Orthologues:
Pon1, Pon2, Pon3
Mouse Descriptions:
paraoxonase 1 Gene [Source:MGI Symbol;Acc:MGI:103295]
paraoxonase 2 Gene [Source:MGI Symbol;Acc:MGI:106687]
paraoxonase 3 Gene [Source:MGI Symbol;Acc:MGI:106686]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28658
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012807 Nonsense 86 356 4 9
ENSDART00000058959 None None 356 None 9
ENSDART00000063083 Nonsense 86 356 4 9
Genomic Location (Zv9):
Chromosome 16 (position 26905582)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 24751257
GRCz11 16 24666289
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGAAGTATCCAGGTTTACCATCTTATTCAGAAGACCCTGGAAAGATCTA[T/A]ACCCTGAATCTGTTGGATTTTAAACCCAAAATCGAATCACTGAGCGTCAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28657
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012807 Nonsense 337 356 9 9
ENSDART00000058959 None None 356 None 9
ENSDART00000063083 None None 356 None 9
Genomic Location (Zv9):
Chromosome 16 (position 26901650)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 24747325
GRCz11 16 24662357
KASP Assay ID:
2260-9655.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TATTCAGATGACGGAAGTGTGATCATCGGCTCATCAGTGGCGGCTCCATA[T/G]AGAGGAAAACTGCTCATCGGAACAGTTTATCAGAAAGCTCTTATCTGTGA
Associated Phenotype:
Not determined