Busch Lab

ZMP

runx2a

Ensembl ID:
ENSDARG00000040261
ZFIN ID:
ZDB-GENE-040629-3
Description:
runt-related transcription factor 2 [Source:RefSeq peptide;Acc:NP_998023]
Human Orthologue:
RUNX2
Human Description:
runt-related transcription factor 2 [Source:HGNC Symbol;Acc:10472]
Mouse Orthologue:
Runx2
Mouse Description:
runt related transcription factor 2 Gene [Source:MGI Symbol;Acc:MGI:99829]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa13625 Nonsense Available for shipment Available now
sa2928 Essential Splice Site F2 line generated Not yet available

Mutation Details

Allele Name:
sa13625
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081849 None None 203 None 5
ENSDART00000081854 None None 57 None 4
ENSDART00000105394 Nonsense 192 467 5 7
ENSDART00000131430 Nonsense 178 453 4 6
Genomic Location (Zv9):
Chromosome 17 (position 5222718)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 5323372
GRCz11 17 5480468
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAGGAGGGGTGTTAAYTGCAATCTCTGTCTAATATTRTTCGTTAGGACAC[A/T]GACAGAAACTGGAAGACCCCCCTAAACCGCCGCTGTTCTCCGAGCGCCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2928
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081849 None None 203 None 5
ENSDART00000081854 None None 57 None 4
ENSDART00000105394 Essential Splice Site 303 467 6 7
ENSDART00000131430 Essential Splice Site 289 453 5 6
Genomic Location (Zv9):
Chromosome 17 (position 5227964)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 5328618
GRCz11 17 5485714
KASP Assay ID:
554-3337.1 (used for ordering genotyping assays)
KASP Sequence:
CGTGCCACCGGCCTGCCCACCATCAGCGACGTGCCACGACGCCTCTCAGG[T/C]ACTCACACCTGCAGAAACCACACAAATTAGGGTACGCTCACACTACRCTA
Associated Phenotype:
Not determined