Busch Lab

ZMP

fstl5

Ensembl ID:
ENSDARG00000040198
ZFIN ID:
ZDB-GENE-070127-1
Description:
follistatin-related protein 5 [Source:RefSeq peptide;Acc:NP_001027012]
Human Orthologue:
FSTL5
Human Description:
follistatin-like 5 [Source:HGNC Symbol;Acc:21386]
Mouse Orthologue:
Fstl5
Mouse Description:
follistatin-like 5 Gene [Source:MGI Symbol;Acc:MGI:2442179]

Alleles

There are 10 alleles of this gene:

Allele Name Consequence Status Availability
sa7399 Missense Mutation detected in F1 DNA Not yet available
sa12250 Nonsense Available for shipment Available now
sa35762 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa35761 Nonsense Mutation detected in F1 DNA Not yet available
sa22551 Nonsense Available for shipment Available now
sa1377 Nonsense Available for shipment Available now
sa19099 Nonsense Mutation detected in F1 DNA Not yet available
sa11024 Nonsense Available for shipment Available now
sa22550 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa7399
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058796 Missense 147 854 5 16
ENSDART00000135479 None None 234 None 1
Genomic Location (Zv9):
Chromosome 14 (position 50077721)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 48154959
GRCz11 14 47142040
KASP Assay ID:
554-4176.1 (used for ordering genotyping assays)
KASP Sequence:
CATACACAGAACTGACYAGCGTTTCTCTTCCACTCTTCACAGATGATAAC[T/C]GCCGYCTGGGAGATTAYAAAAAATTGAAGAGCAAGATGTTGGACATACAT
Long Flanking Sequence:
CCTTTGCTCCTGTTCAGTCCAAACTTCCCAAGGTAACATAAATAGTAAATTGTTTGTGTTGTGAGAAAATGCAACACGTTTTATGAATTTGTTTGGGTTGTGTGAAAATGCAGTGTGTTTTTTAAAGATGTGTTGTGAGTATTTGCAGCACATGTTCTGTCAAACAGATGAAGATATTTTCTTCATTTGCTGGTGTTTTTCGTAATTGCATGTTTTTTCTTAAAATGCAGGACGTTACACCCTTCTGGCCACCGTATTTTGCCTACCAAAAATCCTCAAATTTTTCTGATTCTCAATGTGAGATCCGCAAAAAAAATTACAAATTCTCATCATTTATTTACATAGCAGACCTTTCTAGTTCCTCACACCACCATTAGTGAAAAAGACTTCATATCGGCACAGTATTGATGCATTAGTAATGTTGCAGACCAGTGAATTCATCTCCATTAACATACACAGAACTGACCAGCGTTTCTCTTCCACTCTTCACAGATGATAAC[T/C]GCCGTCTGGGAGATTATAAAAAATTGAAGAGCAAGATGTTGGACATACATGCTCAGAGGTACTTGACCGCCGCTAACCATGGCAGCCACGAGAAGGATATGGCCGCTAGGAAGCATCTGGTGGACATGATGTTTAAGCGATTTGACGCAGACGGCAATGGAAAAGTTGACAGCAGCGAGCTTTCACAGGTAACACTGAACTATAGCCATCAAATCAAACTCATTTAAAAGGCATTAATCTAACATTGACAACAAAAATGTATTATATGACTGCCCCTTAATCAATTTTTGATGTGTTTTTGATACCAATGTTAGATGTTAATTGATTTGTATATTTAAAGTGATTTTTACGACTTTTTATATCATTTGACTGGGTAGTTTCACTAAAAGGTGGCACAAGTAGCATTATTTGAACTGATTTGTTTACTTCCTTATTACCAAAGAGCTTAGAATGACCATGAGGCGACACTCAATAGAACGTTCCACTGCAACAGCAGCGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12250
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058796 Nonsense 192 854 5 16
ENSDART00000135479 None None 234 None 1
Genomic Location (Zv9):
Chromosome 14 (position 50077586)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 48154824
GRCz11 14 47141905
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCCACGAGAAGGATATGGCCGCTAGGAAGCATCTGGTGGACATGATGTTT[A/T]AGCGATTTGACGCAGACGGCAATGGAAAAGTTGACAGCAGCGAGCTTTCA
Long Flanking Sequence:
TGAGTATTTGCAGCACATGTTCTGTCAAACAGATGAAGATATTTTCTTCATTTGCTGGTGTTTTTCGTAATTGCATGTTTTTTCTTAAAATGCAGGACGTTACACCCTTCTGGCCACCGTATTTTGCCTACCAAAAATCCTCAAATTTTTCTGATTCTCAATGTGAGATCCGCAAAAAAAATTACAAATTCTCATCATTTATTTACATAGCAGACCTTTCTAGTTCCTCACACCACCATTAGTGAAAAAGACTTCATATCGGCACAGTATTGATGCATTAGTAATGTTGCAGACCAGTGAATTCATCTCCATTAACATACACAGAACTGACCAGCGTTTCTCTTCCACTCTTCACAGATGATAACTGCCGTCTGGGAGATTATAAAAAATTGAAGAGCAAGATGTTGGACATACATGCTCAGAGGTACTTGACCGCCGCTAACCATGGCAGCCACGAGAAGGATATGGCCGCTAGGAAGCATCTGGTGGACATGATGTTT[A/T]AGCGATTTGACGCAGACGGCAATGGAAAAGTTGACAGCAGCGAGCTTTCACAGGTAACACTGAACTATAGCCATCAAATCAAACTCATTTAAAAGGCATTAATCTAACATTGACAACAAAAATGTATTATATGACTGCCCCTTAATCAATTTTTGATGTGTTTTTGATACCAATGTTAGATGTTAATTGATTTGTATATTTAAAGTGATTTTTACGACTTTTTATATCATTTGACTGGGTAGTTTCACTAAAAGGTGGCACAAGTAGCATTATTTGAACTGATTTGTTTACTTCCTTATTACCAAAGAGCTTAGAATGACCATGAGGCGACACTCAATAGAACGTTCCACTGCAACAGCAGCGCCCAGCAACAGCCCTGGATTCCGCCATTTTGAAGTGAAAGCGATCGGCTGTCCGTAGGATCTCATTACTGTCGCGATGGCAAGCAGCTGCTTTGTTTTTGATTTATTTATTTAAAAAGCACATTAAGACTTAGATAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35762
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058796 Essential Splice Site 250 854 7 16
ENSDART00000135479 None None 234 None 1
Genomic Location (Zv9):
Chromosome 14 (position 50031947)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 48109185
GRCz11 14 47096266
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCTCCTCAAGAGAAAGCTAATCATCAAGCCTTGTGTGTTTTGTTGTCCTC[A/T]GAGGTGTACCAGCTCAGCCTTCCAGAAGAGCAGAAGCTGAGCGTCACCAC
Long Flanking Sequence:
CTTTTAAATTCAGTTCAGCTCTTTCTTTCTCTCCATTCAGTTTTGCTCAACATTTTCAGTGTATTTCATTTGCGTTTAAAACAACATGCTAGCAACACTCAGCAACTTGGAAATTCATGCTATAAACATGCTAGCATCATGCTATTTCATGCTAGAAACATGTTAATTCATGCTAGAAAGCATGCTTCATGTTAGAAATGTTAATTTATGGCAACATTCTTATTCACTAGAAATCATAAATTCTAAACAAGATGCTAATTCTTACTAGAAACATGCTAATTTATTGTTATGAACATGTAAGCGACATGTTAATTTATAGAAGAAACATGTTAGCAATGAGGTAATTATTGTTAGTCATGTTTCTGCATCATTCTGGCTTGATATATTGTGATAGTATTGTAAGTTCAGTAGAGATATGAGTGTTTGGAAGTCTATATTTTTCATCATAGTGCTCCTCAAGAGAAAGCTAATCATCAAGCCTTGTGTGTTTTGTTGTCCTC[A/T]GAGGTGTACCAGCTCAGCCTTCCAGAAGAGCAGAAGCTGAGCGTCACCACGGTAACAGTGGGTCAGAGCGCTGTCCTCACGTGTGCCATCATGGGGGACCAGCGGCCTCCCATCATCTGGAGACGCAACGGCCACGATCTCAACATGATGGAGCTGGAGGACATCAACGTGAGTGATGCTTTTACCATATAGTGTATTTTTGTGTGTGTATGTGTGAGTGTTTCAGCCATCTGTAAAGCACACTCAGGGGCCGATCATGTAGAACATGCTTTTTCATTCTGAGGTCTACTGCACTGAGTTTTTTGTTGGGCTTTTTATGTAATTGTATTTATTTATCTTTTTTTTTTTTTTTTTTTTTTGTAGATTTTTTTTCTCTGCCTGTTCTGTAGTATTCACTAAACTTTGGAGTGATTTCCAAAGTTCTATAATATTTATTCATTCATTCATTTTATTTTCGACTTAGTCCCTTTATTAATCAGGGGTCGCAACCCAACACTGGG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3891
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058796 Nonsense 253 854 7 16
ENSDART00000135479 None None 234 None 1
Genomic Location (Zv9):
Chromosome 14 (position 50031937)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 48109175
GRCz11 14 47096256
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGAAAGCTAATCATCAAGCCTTGTGTGTTTTGTTGTCCTCAGAGGTGTAC[C/T]AGCTCAGCCTTCCAGAAGAGCAGAAGCTGAGCGTCACCACGGTAACAGTG
Long Flanking Sequence:
CAGTTCAGCTCTTTCTTTCTCTCCATTCAGTTTTGCTCAACATTTTCAGTGTATTTCATTTGCGTTTAAAACAACATGCTAGCAACACTCAGCAACTTGGAAATTCATGCTATAAACATGCTAGCATCATGCTATTTCATGCTAGAAACATGTTAATTCATGCTAGAAAGCATGCTTCATGTTAGAAATGTTAATTTATGGCAACATTCTTATTCACTAGAAATCATAAATTCTAAACAAGATGCTAATTCTTACTAGAAACATGCTAATTTATTGTTATGAACATGTAAGCGACATGTTAATTTATAGAAGAAACATGTTAGCAATGAGGTAATTATTGTTAGTCATGTTTCTGCATCATTCTGGCTTGATATATTGTGATAGTATTGTAAGTTCAGTAGAGATATGAGTGTTTGGAAGTCTATATTTTTCATCATAGTGCTCCTCAAGAGAAAGCTAATCATCAAGCCTTGTGTGTTTTGTTGTCCTCAGAGGTGTAC[C/T]AGCTCAGCCTTCCAGAAGAGCAGAAGCTGAGCGTCACCACGGTAACAGTGGGTCAGAGCGCTGTCCTCACGTGTGCCATCATGGGGGACCAGCGGCCTCCCATCATCTGGAGACGCAACGGCCACGATCTCAACATGATGGAGCTGGAGGACATCAACGTGAGTGATGCTTTTACCATATAGTGTATTTTTGTGTGTGTATGTGTGAGTGTTTCAGCCATCTGTAAAGCACACTCAGGGGCCGATCATGTAGAACATGCTTTTTCATTCTGAGGTCTACTGCACTGAGTTTTTTGTTGGGCTTTTTATGTAATTGTATTTATTTATCTTTTTTTTTTTTTTTTTTTTTTGTAGATTTTTTTTCTCTGCCTGTTCTGTAGTATTCACTAAACTTTGGAGTGATTTCCAAAGTTCTATAATATTTATTCATTCATTCATTTTATTTTCGACTTAGTCCCTTTATTAATCAGGGGTCGCAACCCAACACTGGGAAGTTTTATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35761
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058796 Nonsense 394 854 9 16
ENSDART00000135479 None None 234 None 1
Genomic Location (Zv9):
Chromosome 14 (position 50009845)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 48087083
GRCz11 14 47074164
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CACAGCTGTCCTGGCTGAAGAACGGCATGGACATCACCACTAAACTCTCC[A/T]AACAGCTCACACTTCAAGGTACAAACACATCACCTGACGACACTATATAT
Long Flanking Sequence:
CTTCCTCCAGTAGAAAAAAATGTTATAGGAAATATTGTAAAAAAAAAAAAATAAAAATCCTTGCTCTGTTAAACATCATTTGAGAATTATTTGAAGAAGAAAAAAATCACTGGAGTGTGAATAATTTCAACTTTTTATCTGTTATTAAAGGTAGAAATGCTCATAGCTCTTTTCTGTTTTGTAATTTGAATAAAAACTATGTTAGAAAGAAATATACACATATATAGGGGGGGAAAATGTTATTTTAGATGTCGGTTTTATTTCAACAAAGTTAATGAATTACAAAAGAAAATAAAAAATGACCAACTCTGGAGTTCAAGTGTTCATTCACCCTTTTTTTCTCTGTTGTTCTGACAGTCCCTCCTGTTATCCGAGTGTACCCAGAGAGCCAGGCACGTGAGCCGGGCGTCACAGCCAGTCTGCGGTGCTATGCAGAGGGCATCCCTGACCCACAGCTGTCCTGGCTGAAGAACGGCATGGACATCACCACTAAACTCTCC[A/T]AACAGCTCACACTTCAAGGTACAAACACATCACCTGACGACACTATATATAAAAATACACTTCATTGAACATGTACACATATACATCAACTACAGTATATACGATATAACTGCAGGTTTAACTATGTTTATATTAGGGCTGAACGATACTGGAAAAACTGATATTACAATATTTTTTTTCTGTGATACATTTTGCGATTTGAATATAATGTCACAAGATGACATGAGTAACTCTATTTGGAAAGTCTTCCTAATTTTAGAGAAGTGCATCTGCATAAAATATACACAATTATACAAAACTATACCAAATAAAATAAAGCACACATGAAAACAATAAAGCAAAATATAACAACATCAGTTTCCGATGGAGTCTAACAGCATTGAGGTTCAGAAATGCAATATTCAAATATGAATTACCACTGTATATTCTTTATTGTATAAATATTAAACAATAATTTTGTCTTGTGCCCAAATGGTTTGACTTTGCTTGAAATCTTACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22551
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058796 Nonsense 399 854 9 16
ENSDART00000135479 None None 234 None 1
Genomic Location (Zv9):
Chromosome 14 (position 50009830)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 48087068
GRCz11 14 47074149
KASP Assay ID:
2260-7926.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGAAGAACGGCATGGACATCACCACTAAACTCTCCAAACAGCTCACACTT[C/T]AAGGTACAAACACATCACCTGACGACACTATATATAAAAATACACTTCAT
Long Flanking Sequence:
AAAAATGTTATAGGAAATATTGTAAAAAAAAAAAAATAAAAATCCTTGCTCTGTTAAACATCATTTGAGAATTATTTGAAGAAGAAAAAAATCACTGGAGTGTGAATAATTTCAACTTTTTATCTGTTATTAAAGGTAGAAATGCTCATAGCTCTTTTCTGTTTTGTAATTTGAATAAAAACTATGTTAGAAAGAAATATACACATATATAGGGGGGGAAAATGTTATTTTAGATGTCGGTTTTATTTCAACAAAGTTAATGAATTACAAAAGAAAATAAAAAATGACCAACTCTGGAGTTCAAGTGTTCATTCACCCTTTTTTTCTCTGTTGTTCTGACAGTCCCTCCTGTTATCCGAGTGTACCCAGAGAGCCAGGCACGTGAGCCGGGCGTCACAGCCAGTCTGCGGTGCTATGCAGAGGGCATCCCTGACCCACAGCTGTCCTGGCTGAAGAACGGCATGGACATCACCACTAAACTCTCCAAACAGCTCACACTT[C/T]AAGGTACAAACACATCACCTGACGACACTATATATAAAAATACACTTCATTGAACATGTACACATATACATCAACTACAGTATATACGATATAACTGCAGGTTTAACTATGTTTATATTAGGGCTGAACGATACTGGAAAAACTGATATTACAATATTTTTTTTCTGTGATACATTTTGCGATTTGAATATAATGTCACAAGATGACATGAGTAACTCTATTTGGAAAGTCTTCCTAATTTTAGAGAAGTGCATCTGCATAAAATATACACAATTATACAAAACTATACCAAATAAAATAAAGCACACATGAAAACAATAAAGCAAAATATAACAACATCAGTTTCCGATGGAGTCTAACAGCATTGAGGTTCAGAAATGCAATATTCAAATATGAATTACCACTGTATATTCTTTATTGTATAAATATTAAACAATAATTTTGTCTTGTGCCCAAATGGTTTGACTTTGCTTGAAATCTTACATTTACAGGGCTTAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1377
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058796 Nonsense 784 854 16 16
ENSDART00000135479 Nonsense 164 234 1 1
Genomic Location (Zv9):
Chromosome 14 (position 49940216)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 48017454
GRCz11 14 47004535
KASP Assay ID:
554-1289.1 (used for ordering genotyping assays)
KASP Sequence:
CCGGCAGGCAGACGGATGCTCTTTTTGTGGAGCTCAGTTCTGGCAGTGTC[A/T]AAATGATCAAGAGCTTGAAGCAGCCCACGGCGTCGGCGCAGTGGCCCTGG
Long Flanking Sequence:
GCTCTCTCTTCAGGTTTGGTATCGTCCTCCATAAGAATGAACCAGCTCTTCACAAGATCGACTTGGAAACCACGTCATATGTTAAAAACATCAGCCTGCAGCAGTACGACTGTATCCCACAATCCCTGGCTTACACACACCTGGGCGGATATTATCTGGTCAACTGTCGACCGGACTCAACAGGTGCGGCGCGGCCACAATTAATCATCGACAGCATAACAGACAACGTCATGGGCCCTAATGGCGACGTGAGCGGCACACCTTATGTCTCTCCTGATGGCCACTATTTAGTGAGTGTGGACGACCGTGACGGGCTAATGCGCTTACAGCATGTGTCCGTACGGGGAGAGATCGGCCAACCCTTTGACATTCACACCAACCTGCACCTGTCCGATCTGGCCTTCATGCCCTCGTTCACTGAGGCCAACCAGTATAATGTGTTCGGAAGCTCCGGCAGGCAGACGGATGCTCTTTTTGTGGAGCTCAGTTCTGGCAGTGTC[A/T]AAATGATCAAGAGCTTGAAGCAGCCCACGGCGTCGGCGCAGTGGCCCTGGAACCGTCAGAACCGAGTTATGACCGGAAGCGGGCTGTTCGGACAGTATCTCATGACCCCGTCACAAAGCTCCCTGTTTATACTGGATGGGCGTCTGGATAAACTCAACTGTGAGATCACCGACGTTCCCTTGGGAAATACTGTGGTGTGGGTGGGAGAGGCGTAAGACGTCTTAAAAAGGGGGCTTGAGAGGGAAACAACAAACAGGTTGCACTGAATTCGGTCTCTGTTTAATTTATCGAGCAGTTTGGAACTAAATCTAATTTGACTCTGCATTGGAAATGAGAATTGTGGGAAAGGCTTGGCAAGGCTTTCGAGTCAAATAGCTAATAAGTAGTACCAAAAAAAAGTAAAAATGTAAAATTAGATGGTGTCGAACTAGCTTTGATTGAAGGAGATCGAATGAATCGATTTGAGTGATGCGAACGCAGAAATAAATCATCATTCGTCC
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa19099
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058796 Nonsense 822 854 16 16
ENSDART00000135479 Nonsense 202 234 1 1
ENSDART00000058796 Nonsense 822 854 16 16
ENSDART00000135479 Nonsense 202 234 1 1
Genomic Location (Zv9):
Chromosome 14 (position 49940102)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 48017340
GRCz11 14 47004421
KASP Assay ID:
2260-7925.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGTTATGACCGGAAGCGGGCTGTTCGGACAGTATCTCATGACCCCGTCA[C/T]AAAGCTCCCTGTTTATACTGGATGGGCGTCTGGATAAACTCAACTGTGAG
Long Flanking Sequence:
TCCCACAATCCCTGGCTTACACACACCTGGGCGGATATTATCTGGTCAACTGTCGACCGGACTCAACAGGTGCGGCGCGGCCACAATTAATCATCGACAGCATAACAGACAACGTCATGGGCCCTAATGGCGACGTGAGCGGCACACCTTATGTCTCTCCTGATGGCCACTATTTAGTGAGTGTGGACGACCGTGACGGGCTAATGCGCTTACAGCATGTGTCCGTACGGGGAGAGATCGGCCAACCCTTTGACATTCACACCAACCTGCACCTGTCCGATCTGGCCTTCATGCCCTCGTTCACTGAGGCCAACCAGTATAATGTGTTCGGAAGCTCCGGCAGGCAGACGGATGCTCTTTTTGTGGAGCTCAGTTCTGGCAGTGTCAAAATGATCAAGAGCTTGAAGCAGCCCACGGCGTCGGCGCAGTGGCCCTGGAACCGTCAGAACCGAGTTATGACCGGAAGCGGGCTGTTCGGACAGTATCTCATGACCCCGTCA[C/T]AAAGCTCCCTGTTTATACTGGATGGGCGTCTGGATAAACTCAACTGTGAGATCACCGACGTTCCCTTGGGAAATACTGTGGTGTGGGTGGGAGAGGCGTAAGACGTCTTAAAAAGGGGGCTTGAGAGGGAAACAACAAACAGGTTGCACTGAATTCGGTCTCTGTTTAATTTATCGAGCAGTTTGGAACTAAATCTAATTTGACTCTGCATTGGAAATGAGAATTGTGGGAAAGGCTTGGCAAGGCTTTCGAGTCAAATAGCTAATAAGTAGTACCAAAAAAAAGTAAAAATGTAAAATTAGATGGTGTCGAACTAGCTTTGATTGAAGGAGATCGAATGAATCGATTTGAGTGATGCGAACGCAGAAATAAATCATCATTCGTCCTCATTTTCCCACTTGAAAAGACCTCCAAAATGCATTCGGCCCATTTTTTTCCAGTGCCTTGAAGGAACGCTCGCTTAAAAAAGAAAGTAAACATAATTATTCCCTGCGAGCCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11024
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058796 Nonsense 822 854 16 16
ENSDART00000135479 Nonsense 202 234 1 1
ENSDART00000058796 Nonsense 822 854 16 16
ENSDART00000135479 Nonsense 202 234 1 1
Genomic Location (Zv9):
Chromosome 14 (position 49940102)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 48017340
GRCz11 14 47004421
KASP Assay ID:
2260-7925.1 (used for ordering genotyping assays)
KASP Sequence:
GAGTTATGACCGGAAGCGGGCTGTTCGGACAGTATCTCATGACCCCGTCA[C/T]AAAGCTCCCTGTTTATACTGGATGGGCGTCTGGAWAAACTCAACTGTGAG
Long Flanking Sequence:
TCCCACAATCCCTGGCTTACACACACCTGGGCGGATATTATCTGGTCAACTGTCGACCGGACTCAACAGGTGCGGCGCGGCCACAATTAATCATCGACAGCATAACAGACAACGTCATGGGCCCTAATGGCGACGTGAGCGGCACACCTTATGTCTCTCCTGATGGCCACTATTTAGTGAGTGTGGACGACCGTGACGGGCTAATGCGCTTACAGCATGTGTCCGTACGGGGAGAGATCGGCCAACCCTTTGACATTCACACCAACCTGCACCTGTCCGATCTGGCCTTCATGCCCTCGTTCACTGAGGCCAACCAGTATAATGTGTTCGGAAGCTCCGGCAGGCAGACGGATGCTCTTTTTGTGGAGCTCAGTTCTGGCAGTGTCAAAATGATCAAGAGCTTGAAGCAGCCCACGGCGTCGGCGCAGTGGCCCTGGAACCGTCAGAACCGAGTTATGACCGGAAGCGGGCTGTTCGGACAGTATCTCATGACCCCGTCA[C/T]AAAGCTCCCTGTTTATACTGGATGGGCGTCTGGATAAACTCAACTGTGAGATCACCGACGTTCCCTTGGGAAATACTGTGGTGTGGGTGGGAGAGGCGTAAGACGTCTTAAAAAGGGGGCTTGAGAGGGAAACAACAAACAGGTTGCACTGAATTCGGTCTCTGTTTAATTTATCGAGCAGTTTGGAACTAAATCTAATTTGACTCTGCATTGGAAATGAGAATTGTGGGAAAGGCTTGGCAAGGCTTTCGAGTCAAATAGCTAATAAGTAGTACCAAAAAAAAGTAAAAATGTAAAATTAGATGGTGTCGAACTAGCTTTGATTGAAGGAGATCGAATGAATCGATTTGAGTGATGCGAACGCAGAAATAAATCATCATTCGTCCTCATTTTCCCACTTGAAAAGACCTCCAAAATGCATTCGGCCCATTTTTTTCCAGTGCCTTGAAGGAACGCTCGCTTAAAAAAGAAAGTAAACATAATTATTCCCTGCGAGCCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22550
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058796 Nonsense 844 854 16 16
ENSDART00000135479 Nonsense 224 234 1 1
Genomic Location (Zv9):
Chromosome 14 (position 49940035)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 48017273
GRCz11 14 47004354
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACTGGATGGGCGTCTGGATAAACTCAACTGTGAGATCACCGACGTTCCCT[T/A]GGGAAATACTGTGGTGTGGGTGGGAGAGGCGTAAGACGTCTTAAAAAGGG
Long Flanking Sequence:
AGGTGCGGCGCGGCCACAATTAATCATCGACAGCATAACAGACAACGTCATGGGCCCTAATGGCGACGTGAGCGGCACACCTTATGTCTCTCCTGATGGCCACTATTTAGTGAGTGTGGACGACCGTGACGGGCTAATGCGCTTACAGCATGTGTCCGTACGGGGAGAGATCGGCCAACCCTTTGACATTCACACCAACCTGCACCTGTCCGATCTGGCCTTCATGCCCTCGTTCACTGAGGCCAACCAGTATAATGTGTTCGGAAGCTCCGGCAGGCAGACGGATGCTCTTTTTGTGGAGCTCAGTTCTGGCAGTGTCAAAATGATCAAGAGCTTGAAGCAGCCCACGGCGTCGGCGCAGTGGCCCTGGAACCGTCAGAACCGAGTTATGACCGGAAGCGGGCTGTTCGGACAGTATCTCATGACCCCGTCACAAAGCTCCCTGTTTATACTGGATGGGCGTCTGGATAAACTCAACTGTGAGATCACCGACGTTCCCT[T/A]GGGAAATACTGTGGTGTGGGTGGGAGAGGCGTAAGACGTCTTAAAAAGGGGGCTTGAGAGGGAAACAACAAACAGGTTGCACTGAATTCGGTCTCTGTTTAATTTATCGAGCAGTTTGGAACTAAATCTAATTTGACTCTGCATTGGAAATGAGAATTGTGGGAAAGGCTTGGCAAGGCTTTCGAGTCAAATAGCTAATAAGTAGTACCAAAAAAAAGTAAAAATGTAAAATTAGATGGTGTCGAACTAGCTTTGATTGAAGGAGATCGAATGAATCGATTTGAGTGATGCGAACGCAGAAATAAATCATCATTCGTCCTCATTTTCCCACTTGAAAAGACCTCCAAAATGCATTCGGCCCATTTTTTTCCAGTGCCTTGAAGGAACGCTCGCTTAAAAAAGAAAGTAAACATAATTATTCCCTGCGAGCCTGTGGATAAAACGCGGAGAGAATGCGAGAGCTACACTTTAAATTTCACCTGTTTATAACTCCCACAGAC
Associated Phenotype:
Not determined