Busch Lab

ZMP

zgc:194176

Ensembl ID:
ENSDARG00000040180
ZFIN ID:
ZDB-GENE-080716-17
Description:
CMP-sialic acid transporter [Source:RefSeq peptide;Acc:NP_001122283]
Human Orthologue:
SLC35A1
Human Description:
solute carrier family 35 (CMP-sialic acid transporter), member A1 [Source:HGNC Symbol;Acc:11021]
Mouse Orthologue:
Slc35a1
Mouse Description:
solute carrier family 35 (CMP-sialic acid transporter), member 1 Gene [Source:MGI Symbol;Acc:MGI:134

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29294
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058777 Essential Splice Site 167 337 4 8
ENSDART00000132917 None None 170 None 4
Genomic Location (Zv9):
Chromosome 20 (position 2702063)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 2656247
GRCz11 20 2673223
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGGAGTCACGCTGGTGCAGTGGACGCCGCCGCACTCCACCAAAGTACAGG[T/C]ACTGTAAGGCCCAATCACAATTCTGTTTTTTTTATTTCAACCCCTACTCC
Long Flanking Sequence:
TCAAATCTTCAGACCAATCAGATGCTCCCTAGTGTCTGACATGCCCCTCCCCCTTCTCTTCAATGGCTTTTGTTTATTTGTGTGTGCATTTCTGCGTGTCTGGATGTGTTTTTGTGGCATATCAGTACACAAATGTGTATAATGTCATGGTTATGACACAAAAAAAAGCATATAAATCATGCTAAAGTTTTTTTAGTGGCTTTAGAAAGTAAAGCTGTAGAGGTTAGGCGGTAGAAAAAATTGTTAGGGAAATAGAAAATACAGCTTATACAGTATAAAAGCAATGGAAACTTATGAAATGTCCTTACTATTCACAAAAACTAACCTGTGTGTGTGTGTGTTTTAGGTGACATACCAGCTGAAGATACCGTGTACGGCGCTGTGTACGGTGCTGATGCTGAACCGCTCTCTGAGCCGCCTGCAGTGGTTCTCCGTCTTCATGCTGTGTGCGGGAGTCACGCTGGTGCAGTGGACGCCGCCGCACTCCACCAAAGTACAGG[T/C]ACTGTAAGGCCCAATCACAATTCTGTTTTTTTTATTTCAACCCCTACTCCTTCCCCTTGTTCCTTTAACAGGAAAGTAGGCTAAACGTGTTCTCTGAGGATGACAAACTGACAAAACATTGCTGTCGCCCTGATACAAGTTTTATTTATGAAGAAAAGCACTGCAGTGTTTGGGTGATCTGTGAGAAAATTGAAAATTAGTCTTACTGAAATGTGAATATTCCATACAAGCTGAAGCTGATCGCTCAATTCCTGTCACGTGACTCACAATGCACTCGCATCGCGGCCCGGGGTTCATTGGTGCAAGCGTGTCACGCCACTTATGCGCGCATGACGCGCACCTCCATTGGAAACAAACTTGTGCAAACTCTAGAAATACGCAATATGCCGCTGTCATTTAGGATCTCCATCAGTAGATCTTCTTGCACAGCCATGGTGGATTCACCTGGTTTGTTGACAAGTGGGCTGCGGATCTGTTCCTTGGCAGTTCGCGGGTCCTTC
Associated Phenotype:
Not determined