Busch Lab

ZMP

nek4

Ensembl ID:
ENSDARG00000040152
ZFIN ID:
ZDB-GENE-040426-1392
Description:
serine/threonine-protein kinase Nek4 [Source:RefSeq peptide;Acc:NP_957306]
Human Orthologue:
NEK4
Human Description:
NIMA (never in mitosis gene a)-related kinase 4 [Source:HGNC Symbol;Acc:11399]
Mouse Orthologue:
Nek4
Mouse Description:
NIMA (never in mitosis gene a)-related expressed kinase 4 Gene [Source:MGI Symbol;Acc:MGI:1344404]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa6189 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa8401 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa21837 Nonsense Available for shipment Available now
sa31813 Essential Splice Site Available for shipment Available now
sa27717 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa6189
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058728 Essential Splice Site 118 849 2 16
Genomic Location (Zv9):
Chromosome 11 (position 4083263)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 4001767
GRCz11 11 4021154
KASP Assay ID:
554-4822.1 (used for ordering genotyping assays)
KASP Sequence:
TGAGAGACAGGTGGTGGAGTGGTTTGTTCAGATCGCCATGGCTCTTCAGG[T/C]AAGTTAATAGMCATTCTTCTCACTAGGGGTGTAAAAATACATCAATATTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8401
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058728 Essential Splice Site 221 849 5 16
Genomic Location (Zv9):
Chromosome 11 (position 4076882)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 3995386
GRCz11 11 4014773
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
WACCTCCTCGCATTATACTAACATCATTGATTATTTACTTTCAATATTCA[G/A]TTACCACAGATGCCRAGTAAGTACGACCCTCAGCTRGGAGAACTGATAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21837
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058728 Nonsense 277 849 6 16
Genomic Location (Zv9):
Chromosome 11 (position 4076631)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 3995135
GRCz11 11 4014522
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CACGCATTGATCTGTCCTGTTACTGATTCTGAACAGGAAAACCGCCAAGT[C/A]ACGGAAAAATGCAGCGAATGGCAAACTGAACAGTGCTGGATCAGATGCGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31813
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058728 Essential Splice Site 316 849 6 16
Genomic Location (Zv9):
Chromosome 11 (position 4076511)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 3995015
GRCz11 11 4014402
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGTTCAGCCACAGTGTCTCAACTCTGAGTCAAAGACCTGCGGAAAAAAGG[T/C]TAGAGGAATGCCATCTTGGAAATCTTATGCACGTGTGTTTTAAATCGACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27717
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058728 Nonsense 631 849 11 16
Genomic Location (Zv9):
Chromosome 11 (position 4065935)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 3984439
GRCz11 11 4003826
KASP Assay ID:
2260-3863.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTCAGCCAGAGAGAGGAGAAGACTGAAGCAGTCGCAGGAGAACTCCACA[C/T]AACAAGGTGTGAGGATTTCTGGGAATTCAATGTTATTTTAATGTAAATGA
Associated Phenotype:
Not determined