Busch Lab

ZMP

LOC570258

Ensembl ID:
ENSDARG00000040137
Human Orthologue:
JDP2
Human Description:
Jun dimerization protein 2 [Source:HGNC Symbol;Acc:17546]
Mouse Orthologue:
Jdp2
Mouse Description:
Jun dimerization protein 2 Gene [Source:MGI Symbol;Acc:MGI:1932093]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4728
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058707 Essential Splice Site 103 199 2 4
Genomic Location (Zv9):
Chromosome 17 (position 50731400)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 50122217
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACATCTACTGGGAAAACWGGGCAAGCGGACACTCCCGATCAAAGCGGAGG[T/C]GAGCAAACTGTCATTCATTCATTTTCTTTTCGGCTTAGTCCCTTTATTAA
Long Flanking Sequence:
CTGACCCAGCCGAGGCTCGAACCAGCGACCTTCTTGCTGAGAGGCGATCATTGCGCCATGACGCCACACATAAAATGAACTTTGCTTATTGAACTTATTTGTGATATGGATATTGCTTATACCATAATCAAGATAACTATAATTGTTTGATATGTTGTGCAGCGTTATTATTAATTAATTAGTCATATTGTGAATTAGTTTGCTTCTGATGACTGATTTCATTGCATTGGACAGCCTGCTGTATTAAGCATCCTCTGCTCTTTTCTTTTATTGTTATTCAGCTGTGGTCGCGGGTGTTTGTGACATGATGCCCGGTCAGATCCCGGACCCCTCAGTGACGGCGGGCTCTCTGCCCAGTTTGGGCCCTCTAGCGGGCATTTCTGCCACCACACTCTCTGAACACCTGAAATATGCAGACCTCTGCCACATTGGGGCCATGCTGTCCCCGTTACATCTACTGGGAAAACTGGGCAAGCGGACACTCCCGATCAAAGCGGAGG[T/C]GAGCAAACTGTCATTCATTCATTTTCTTTTCGGCTTAGTCCCTTTATTAATCTGGGGTCGCCACAGCGGAATGAACCGCCAACTTATCCAGCAGCGGATGCCCTTCCTGCTGCAACCCGTCACTGGGAAACACCCATACACACTCATTCACACACATACACTACAGACATTTTAGCCTACCCTATTCACCATAACATTTTTGTGGACTTGTGGGGGGAAACCGGAGCACCCGGAGGAAACCCACGTGAACACAGGGAGAACATGCAAACTCCACATTGAAACGCCAACTGACCCAGCTGAGGCTCGAACCAGTGACCTTCTTGCTGTGAGGTGCTACCCACTGTGCCAATGTGACGCCAATTTGCAGCAATATATAGCTTCTATAGTTTCTGATATAACGTGATGACTAGAGATGCAACGATTAACCGATTTCACTAATAACCGCGCTTTAATTCGTCTCTGTTAATTAATCGTGAAGGCTTCTTAACACCGTGTTTCTG
Associated Phenotype:
Not determined