Busch Lab

ZMP

zfpm2a

Ensembl ID:
ENSDARG00000040123
ZFIN ID:
ZDB-GENE-060130-4
Description:
zinc finger protein ZFPM2 [Source:RefSeq peptide;Acc:NP_001034724]
Human Orthologue:
ZFPM2
Human Description:
zinc finger protein, multitype 2 [Source:HGNC Symbol;Acc:16700]
Mouse Orthologue:
Zfpm2
Mouse Description:
zinc finger protein, multitype 2 Gene [Source:MGI Symbol;Acc:MGI:1334444]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa36240 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa42806 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa36240
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058685 Essential Splice Site 140 1142 None 8
ENSDART00000102414 Essential Splice Site 139 194 None 6
ENSDART00000104583 Essential Splice Site 140 195 None 5
ENSDART00000141941 Essential Splice Site 41 1042 None 5
Genomic Location (Zv9):
Chromosome 16 (position 46823920)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 44023690
GRCz11 16 43971138
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CACATGGGGGCCTTTCGAGGGCAAAATTGAGCTGAACACAGACGCACAGG[T/C]ACAGTCCATCTCGTTTAAATGTTGATGAGGGTTAAAGGCCAAACATGCAA
Long Flanking Sequence:
GCCAAAGTATTCGATAGCTCAACTGTTTCATTTAGTCAACTTAAAATAGAAAATAAATCGTTATGTTAACTTAATCAATTTGTGTTGGGATGACATGAAGGGATTGGGTGGAACTCAGCATTTTTTTGGTGTATGGTATTTGTATGCTTTAGAAGTGTCAAAAACTTACACACAGCACTTGTAAAATTGTGTAAAAATGTCTCTAAATTCGAACATTCTTTGAAACATTTGGGATAATGTAAGTAAACAAGTCAGCAAAAAAAAATTGTTCTATGAATCTTTGCATATTTTAATGATACAATCTTACATATTGTGCCTTTAAATCCCCTTGAAGCATTTATTACACCTCCTAACACTGACTATCCTGTTCTGTCACACAGGAGAGCTGGACCTATTCAACAAAGATGGAGAACGGCGGATTCACAGCCGCCAGCAGCTTCCTGTAGGAACCACATGGGGGCCTTTCGAGGGCAAAATTGAGCTGAACACAGACGCACAGG[T/C]ACAGTCCATCTCGTTTAAATGTTGATGAGGGTTAAAGGCCAAACATGCAATTTATGCACTACTTAAAGGAAACTGCACCAACTTCATTTAATACGTGTGTTTAAAAGCGATCGATCTGTTTACTTGCTGAATCAATGGGATGGATTTGGTAAGGTTATTTGTTTTTATCAACTTTTTGCTATACTGTTGAAGCACACATTACATACTTCACCTTTAATAGAGTCTCTATATTTGTAAGTCCGTCCATGAAGCGGTTCATTATTAGAGGTGAAGCTTATTATCTTTGAAGACCTTTATTTGCATATTGACAAAGGAGAAAGTTTACTGAACATCAACAGATGTTAATAGTGTTATATACAGATCGTAACCCAGGGCTTCTTGAACATCCCAGTATCACACCGACCTGCTTTGTGAATTTAACTGTTTATTTGCATATTTTATTGCTAAAATTGATGGGTTTTACATATATACAGTTGAAGTCACTATTATTAGCCTTCCTG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28734
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058685 Essential Splice Site 321 1142 7 8
ENSDART00000102414 None None 194 None 6
ENSDART00000104583 None None 195 None 5
ENSDART00000141941 Essential Splice Site 221 1042 4 5
Genomic Location (Zv9):
Chromosome 16 (position 46675389)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 43875159
GRCz11 16 43822607
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGCTTCAGCAACCCTCGTGCTCTGGAGATGCACTTGAGCTCGCACAGCA[G/A]TGAGTATACAGTATGCAGTAATATGCACAGTACATTTGGACAGATTTTAA
Long Flanking Sequence:
GTGTTTGAGCAATTTCTTCTTCTTCCATGGCTTTGCATAACACACCTTCCAATATGTCCCCTTCTCAGCCTTTTGACCCCGATGCCCAACCATAGTAACCATAGTCCATAGTAATAGTCAAAGGGCACAAGACTTTCCACTTTGTATTTTACTGAATGAAAAGTATGGACCAGCAAATGGGACTGTGACTGGAACTTGGGTCACCAGAGTGCTGCCCACGAGCTATATCCCACTGCATGTGGTTATGTATTCACATTCTTGTCTCTGTTTTTCAGAGGACATCTTTCCCTGTAAAGCATGTGGGATATGGTACCGGAGTGAGAGAAACCTTCAGGCCCACCTGATGTATTACTGCAGTGGGCGGCAGAGAGAACCTGACAACGTCCCTGAAGAGACTGACGCCATTTCCCATCAAACTCCCAGTATCTGCCCTTTTCCGCAATGCAACAAGAGCTTCAGCAACCCTCGTGCTCTGGAGATGCACTTGAGCTCGCACAGCA[G/A]TGAGTATACAGTATGCAGTAATATGCACAGTACATTTGGACAGATTTTAAACACGTTATTTGATCATTGCACATTACATAACAGGAGTACATACAAGCAGTAAAACCTGGTCATATTATCAACATTCTATATATATTATACTCGCAGCACAAACTAAATCCACACGTATTAAACATTAACTATCATGCTGAAGGATGACAATAAAAACAACTGTCTTTCTTTTTCACAGGTGTCAAAATGGAGGAGACCCTTCCCCCTGGCACAAGCTTGAAATGCACAATCTGTAACTTCACAGCAGATTCGCTCCTTACATTCCAGCACCACATCCTTTCACACCTGTCACAGGCAGCCTTCAGATGCAATCACTGCCACATCAGCTTCCAGAACCACAGGGAACTGCTGCAGCATCAAGACTTACATGGACACTCTGGGAAGATTCACAGAGAGAGTGACAGTGAAAACTCCCCAAGAGGAGGAGAGGATAGTCTGCAGGCGGCAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42806
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058685 Nonsense 1069 1142 8 8
ENSDART00000102414 None None 194 None 6
ENSDART00000104583 None None 195 None 5
ENSDART00000141941 Nonsense 969 1042 5 5
Genomic Location (Zv9):
Chromosome 16 (position 46672917)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 43872687
GRCz11 16 43820135
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AATCAGCCTCACAATACCTCATTGCCAGAGGAACAAACATCTCCCACATG[G/A]GGAGCCGAGAACCCTCCCGACCCAAACGAGAATGTATCACCAACTTCTAA
Long Flanking Sequence:
AGTTCTGTGAAATGCGAGAAAAATGGAGGCAACAAATTGATGCAAAATGGAGGCATGTTCCCACCACACCTCGGCTCCGCACCGGATCTGAAAGCTTTCGCTGATGCACAGCTAATGTCCTCGAAAGATGAGAACAAGAACATGTTTTTGCCTCACTCTCTCTATCCTGGAGCAATAAAGAAGGTGAAAGGTACCGAGCAAATATCACCGTATTTCGGGATTAAGAGTGGCGACTACATGGCAGGGAGTCTCGTCGTGCAGGCTGAGGCAGCCGAACAGGAGCAAAGCAGCAATGGTGCAGGTGAGCCAGGCACAGAATCACTTGCAGCCAATGGCTGTCCCCATCCCAACAAAGATCCACTGCCCCTGCTACCTAAAAATAGGAGCATGGTGATTGTCAATGGTGGTCATAAAGAGGATCGCCAGACACCAGCAACTCCCCAGCAAGAGAATCAGCCTCACAATACCTCATTGCCAGAGGAACAAACATCTCCCACATG[G/A]GGAGCCGAGAACCCTCCCGACCCAAACGAGAATGTATCACCAACTTCTAAATCACCCGTGGAGGATTCGGCACCCGCCGGGAAAGGTATTAATGGGTCGGCGTCGCCAGCAGGCAGTGGGAAGTACTGCCGCCTCTGTGACATCCAGTTCAATAACTTGTCAAACTTTATCACTCATAAGAAGTTTTACTGCTCGTCACATGCTGCCGAGCATGTGAAATGAAACTGCAGTCTTTTCCCCTTGTTCTCCCCTCTTTTTTGGGTACACGGTTGTGAAATAGTGCATCATGCAGTTTTATATACTGCTTGTGGACAATCAAGAGAAGCTTCTTCTTTCGTTATTTGAAGACTTAATGCAAAACGATGAAAAAACAAAAAAATCCAAGTGTAATATTGGTGCCACTTTCACCTTTTATTTATTTTACAATCAGTATTATTAGGAGTAGTGCTCTTAATTTAAATTCAAAGAAAGTTTATATCAGAGTTGTTTGTAATGTTAAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa42805
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058685 Nonsense 1072 1142 8 8
ENSDART00000102414 None None 194 None 6
ENSDART00000104583 None None 195 None 5
ENSDART00000141941 Nonsense 972 1042 5 5
Genomic Location (Zv9):
Chromosome 16 (position 46672910)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 43872680
GRCz11 16 43820128
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTCACAATACCTCATTGCCAGAGGAACAAACATCTCCCACATGGGGAGCC[G/T]AGAACCCTCCCGACCCAAACGAGAATGTATCACCAACTTCTAAATCACCC
Long Flanking Sequence:
TGAAATGCGAGAAAAATGGAGGCAACAAATTGATGCAAAATGGAGGCATGTTCCCACCACACCTCGGCTCCGCACCGGATCTGAAAGCTTTCGCTGATGCACAGCTAATGTCCTCGAAAGATGAGAACAAGAACATGTTTTTGCCTCACTCTCTCTATCCTGGAGCAATAAAGAAGGTGAAAGGTACCGAGCAAATATCACCGTATTTCGGGATTAAGAGTGGCGACTACATGGCAGGGAGTCTCGTCGTGCAGGCTGAGGCAGCCGAACAGGAGCAAAGCAGCAATGGTGCAGGTGAGCCAGGCACAGAATCACTTGCAGCCAATGGCTGTCCCCATCCCAACAAAGATCCACTGCCCCTGCTACCTAAAAATAGGAGCATGGTGATTGTCAATGGTGGTCATAAAGAGGATCGCCAGACACCAGCAACTCCCCAGCAAGAGAATCAGCCTCACAATACCTCATTGCCAGAGGAACAAACATCTCCCACATGGGGAGCC[G/T]AGAACCCTCCCGACCCAAACGAGAATGTATCACCAACTTCTAAATCACCCGTGGAGGATTCGGCACCCGCCGGGAAAGGTATTAATGGGTCGGCGTCGCCAGCAGGCAGTGGGAAGTACTGCCGCCTCTGTGACATCCAGTTCAATAACTTGTCAAACTTTATCACTCATAAGAAGTTTTACTGCTCGTCACATGCTGCCGAGCATGTGAAATGAAACTGCAGTCTTTTCCCCTTGTTCTCCCCTCTTTTTTGGGTACACGGTTGTGAAATAGTGCATCATGCAGTTTTATATACTGCTTGTGGACAATCAAGAGAAGCTTCTTCTTTCGTTATTTGAAGACTTAATGCAAAACGATGAAAAAACAAAAAAATCCAAGTGTAATATTGGTGCCACTTTCACCTTTTATTTATTTTACAATCAGTATTATTAGGAGTAGTGCTCTTAATTTAAATTCAAAGAAAGTTTATATCAGAGTTGTTTGTAATGTTAATGTATAGT
Associated Phenotype:
Not determined