Busch Lab

ZMP

znf750

Ensembl ID:
ENSDARG00000040098
ZFIN ID:
ZDB-GENE-050417-313
Description:
Protein ZNF750 [Source:UniProtKB/Swiss-Prot;Acc:Q568E2]
Human Orthologue:
ZNF750
Human Description:
zinc finger protein 750 [Source:HGNC Symbol;Acc:25843]
Mouse Orthologue:
Zfp750
Mouse Description:
zinc finger protein 750 Gene [Source:MGI Symbol;Acc:MGI:2442210]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa12681 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12681
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058643 Nonsense 213 607 2 3
Genomic Location (Zv9):
Chromosome 3 (position 49416770)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 44111190
GRCz11 3 48256601
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCTCCATACATGGTGCCCGAAAGGTCCTTGCCTCCCCTCTACGCACCCTA[C/A]CCACATAACCAAGCAAGCACTCCAGCCTACCAAGTAACACCTCGAGAGAC
Associated Phenotype:
Not determined