Busch Lab

ZMP

fli1b

Ensembl ID:
ENSDARG00000040080
ZFIN ID:
ZDB-GENE-031114-3
Description:
friend leukemia integration 1b [Source:RefSeq peptide;Acc:NP_001008780]
Human Orthologue:
FLI1
Human Description:
Friend leukemia virus integration 1 [Source:HGNC Symbol;Acc:3749]
Mouse Orthologue:
Fli1
Mouse Description:
Friend leukemia integration 1 Gene [Source:MGI Symbol;Acc:MGI:95554]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa36230 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa36230
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058613 Nonsense 186 467 4 9
ENSDART00000102789 Nonsense 176 458 4 9
ENSDART00000121474 Nonsense 176 458 5 10
ENSDART00000124717 Nonsense 176 485 4 10
ENSDART00000134010 Nonsense 176 457 4 9
Genomic Location (Zv9):
Chromosome 16 (position 44809417)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 42089925
GRCz11 16 42039957
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTCCCTCTTCCAGACCCTGGATGGAAAAGCGCTCTGCAAATTGAGCAAA[G/T]AGGACATGATGCGCATCACCTCCGCATACAACACAGACATCCTGCTCTCC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa762
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058613 Essential Splice Site 210 467 5 9
ENSDART00000102789 Essential Splice Site 200 458 5 9
ENSDART00000121474 Essential Splice Site 200 458 6 10
ENSDART00000124717 Essential Splice Site 200 485 5 10
ENSDART00000134010 Essential Splice Site 200 457 5 9
Genomic Location (Zv9):
Chromosome 16 (position 44809651)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 42090159
GRCz11 16 42040191
KASP Assay ID:
554-0668.1 (used for ordering genotyping assays)
KASP Sequence:
TTTATAAATGTAGTAGATTAAAACGGCTTGTTTTTTACTATTGTTTATTC[A/T]GGTAGTCCCACTTTTTCCTACCCAACAAATCCAACTAATACACAACCACA
Associated Phenotype:
Not determined