Busch Lab

ZMP

si:ch211-15e22.3

Ensembl ID:
ENSDARG00000040048
ZFIN ID:
ZDB-GENE-090312-115
Description:
polypeptide N-acetylgalactosaminyltransferase-like 6 [Source:RefSeq peptide;Acc:NP_001139074]
Human Orthologue:
GALNTL6
Human Description:
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 6 [Source:HGNC
Mouse Orthologue:
Galnt10
Mouse Description:
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 10 Gene [Source:MGI

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa39647 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa10501 Essential Splice Site Available for shipment Available now
sa18048 Nonsense Available for shipment Available now
sa5940 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa25626 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa39647
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058574 Essential Splice Site 128 600 3 12
ENSDART00000139448 Essential Splice Site 128 600 4 13
Genomic Location (Zv9):
Chromosome 1 (position 38273882)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 37145338
GRCz11 1 37864516
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGCAACAATATCGCTCTGGATCGCTCGCTTCCTGACATCCGACATCCAAA[G/T]TGAGTAGAGCTGATTCTTCACCGCCTCCAGAGCTGCACAGCTTGAGCGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10501
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058574 Essential Splice Site 246 600 5 12
ENSDART00000139448 Essential Splice Site 246 600 6 13
Genomic Location (Zv9):
Chromosome 1 (position 38470186)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 37341642
GRCz11 1 38060820
KASP Assay ID:
2259-0828.1 (used for ordering genotyping assays)
KASP Sequence:
CTGGATTCTCATTGTGAAGCCAACATCAACTGGCTGCCACCCTTGCTTGG[T/C]GAGTCCAGWTATACAGTATATATNAAAAAAGAAAGAAAAATACCAACCCTG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa25625
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058574 Nonsense 454 600 9 12
ENSDART00000139448 Nonsense 454 600 10 13
Genomic Location (Zv9):
Chromosome 1 (position 38522229)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 37393685
GRCz11 1 38112863
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGGACCTGCCCAAATATTACCCACCTGTGGAGCCACTGCCAGCTGCCTG[G/A]GGAGAGGTGGGTGAACCCTATTAAAAACGTGAGCCGCACACAACTGAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18048
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058574 Nonsense 543 600 11 12
ENSDART00000139448 Nonsense 543 600 12 13
Genomic Location (Zv9):
Chromosome 1 (position 38535158)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 37406614
GRCz11 1 38125792
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATCACGCTCTATGACTGCCATGGCATGAAAGGCAACCAGCACTGGAGCTA[C/A]AGGAAGGYAAAGCAAATWATCTGCTTGTCAATATTTTGTGACAGAAAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5940
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058574 Essential Splice Site 545 600 11 12
ENSDART00000139448 Essential Splice Site 545 600 12 13
Genomic Location (Zv9):
Chromosome 1 (position 38535166)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 37406622
GRCz11 1 38125800
KASP Assay ID:
554-3851.1 (used for ordering genotyping assays)
KASP Sequence:
CTATGACTGCCATGGCATGAAAGGCAACCAGCACTGGAGCTACAGGAAGG[T/C]AAAGCAAATWATCTGCTTGTCAATATTTTGTGACAGAAAGAATTTCAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25626
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058574 Nonsense 580 600 12 12
ENSDART00000139448 Nonsense 580 600 13 13
Genomic Location (Zv9):
Chromosome 1 (position 38540458)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 37411914
GRCz11 1 38131092
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACGATAAGCGGATTTTCATGAACAAGTGTGATCCCAAGTCTGAAACACAA[C/T]AGTGGATCTTCCAGAAAGTCAACGCCACCGTTCTGGACAAATTCAACAGC
Associated Phenotype:
Not determined