Busch Lab

ZMP

trmt11

Ensembl ID:
ENSDARG00000040033
ZFIN ID:
ZDB-GENE-040426-953
Description:
tRNA guanosine-2'-O-methyltransferase TRM11 homolog [Source:RefSeq peptide;Acc:NP_956510]
Human Orthologue:
TRMT11
Human Description:
tRNA methyltransferase 11 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:21080]
Mouse Orthologue:
Trmt11
Mouse Description:
tRNA methyltransferase 11 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1920931]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa42790 Nonsense Mutation detected in F1 DNA Not yet available
sa2875 Nonsense F2 line generated Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28719
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102552 Essential Splice Site 48 466 2 13
ENSDART00000125484 Essential Splice Site 48 384 2 12

The following transcripts of ENSDARG00000040033 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 42710566)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 40094016
GRCz11 16 40044048
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTCTCTAAGGGACCGGCCGTTTGAGACACCCGAAACATTTAAAGAAAAG[G/A]TAGTGTCGAAATAGTTTTTCACTTGGCGTAAAGTAATTGTTATGAATTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42790
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102552 Nonsense 115 466 5 13
ENSDART00000125484 Nonsense 115 384 5 12

The following transcripts of ENSDARG00000040033 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 42713058)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 40096508
GRCz11 16 40046540
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCACAGGCTCCATATCTGCAGCAAAACTCAACCTATAAGATCAATGTCTA[C/A]ACTTTTAACAAAACATTAGAATTTAAGGACAGAATCAAAAAAATCGATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2875
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102552 Nonsense 285 466 9 13
ENSDART00000125484 Nonsense 285 384 9 12

The following transcripts of ENSDARG00000040033 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 42719259)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 40102709
GRCz11 16 40052741
KASP Assay ID:
554-3319.1 (used for ordering genotyping assays)
KASP Sequence:
GATGAGAACATTCGAGCAAACTTGCGTCAGTATGGGGCTGAAAATCTCTA[T/A]GTGGACGTCATGGTGTCTGATGCCTCCAAACTGGTTTGGAGACGAAATGC
Associated Phenotype:
Not determined