Busch Lab

ZMP

FBN1 (1 of 2)

Ensembl ID:
ENSDARG00000040013
Description:
fibrillin 1 [Source:HGNC Symbol;Acc:3603]
Human Orthologue:
FBN1
Human Description:
fibrillin 1 [Source:HGNC Symbol;Acc:3603]
Mouse Orthologue:
Fbn1
Mouse Description:
fibrillin 1 Gene [Source:MGI Symbol;Acc:MGI:95489]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa9112 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28963
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058537 Nonsense 436 940 12 26
Genomic Location (Zv9):
Chromosome 18 (position 4756522)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 5515220
GRCz11 18 5332449
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTGCTGCAGATGAATTCGCTGTGCTGTGTGGAAGTGAGAGGCCGGGATA[T/A]TTCATTGACATCTACACTGGACAGATTATTGGTAAACACACACACACACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9112
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058537 Nonsense 547 940 15 26
Genomic Location (Zv9):
Chromosome 18 (position 4755724)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 5514422
GRCz11 18 5331651
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GACCGTAAYGAGTGTGCTGARAATCCTAACATCTGCAGTCCTGGTCAGTG[T/A]ATTGATATGGTGGGCAGTTACCGCTGCATCTGCCCCAACGGCTTCAAGTC
Associated Phenotype:
Not determined