Busch Lab

ZMP

si:ch211-244a23.1

Ensembl ID:
ENSDARG00000040004
ZFIN ID:
ZDB-GENE-060503-789
Description:
fibrocystin-L isoform 1 [Source:RefSeq peptide;Acc:NP_001123871]
Human Orthologue:
PKHD1L1
Human Description:
polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1 [Source:HGNC Symbol;Acc:20313]
Mouse Orthologue:
Pkhd1l1
Mouse Description:
polycystic kidney and hepatic disease 1-like 1 Gene [Source:MGI Symbol;Acc:MGI:2183153]

Alleles

There are 18 alleles of this gene:

Allele Name Consequence Status Availability
sa25091 Nonsense Mutation detected in F1 DNA Not yet available
sa7455 Missense Mutation detected in F1 DNA Not yet available
sa23518 Nonsense Available for shipment Available now
sa29202 Nonsense Mutation detected in F1 DNA Not yet available
sa43278 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa14852 Nonsense Mutation detected in F1 DNA Not yet available
sa1501 Nonsense Available for shipment Available now
sa14766 Nonsense Available for shipment Available now
sa23519 Nonsense Available for shipment Available now
sa36835 Nonsense Mutation detected in F1 DNA Not yet available
sa43279 Nonsense Mutation detected in F1 DNA Not yet available
sa23520 Nonsense Available for shipment Available now
sa10779 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4811
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050456 Essential Splice Site 22 3895 1 70
ENSDART00000124987 Essential Splice Site 22 4201 1 76

The following transcripts of ENSDARG00000040004 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 23421075)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 23350490
GRCz11 19 22934813
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTGCAGCTTCACCTGACACTCACTGTTTGCATTTTACTNNNGAGTTCAGCAGG[T/A]AAGCGCTGGATGTATTTATTTTAGATTATATATTAGGCTGCTGCAKYCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25091
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050456 Nonsense 28 3895 2 70
ENSDART00000124987 Nonsense 54 4201 3 76

The following transcripts of ENSDARG00000040004 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 23423142)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 23352557
GRCz11 19 22936880
KASP Assay ID:
554-7635.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAAATGTATCTAATAGACATTTTCTTTTCTTAGGTTTTGCACAAGCCAGC[C/T]AGTTCAATCTCAATGCCAATGACCCAAACCTTGGCAACAAAGTCACACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7455
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050456 Missense 433 3895 14 70
ENSDART00000124987 Missense 459 4201 15 76

The following transcripts of ENSDARG00000040004 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 23432891)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 23362306
GRCz11 19 22946629
KASP Assay ID:
554-4186.1 (used for ordering genotyping assays)
KASP Sequence:
AMATTCTCTTYACKTGCTACAGGTACTATATTGAGGTTTTAGTGCACGGA[T/C]ATTCWGGATCAGCATCAGTAGATGTGGGCTTTTTCAAAGAGATCAGCCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23518
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050456 Nonsense 495 3895 15 70
ENSDART00000124987 Nonsense 521 4201 16 76

The following transcripts of ENSDARG00000040004 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 23433211)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 23362626
GRCz11 19 22946949
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCATTTTAAAGGATGGAAGCCAACAAGCGCTATCAGAGAGGTTCAGATTT[T/A]GAGAATCAGCAGTGCATGTTTTTCTCTGAACACCTGTGAACTCACATACT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29201
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050456 Essential Splice Site 570 3895 16 70
ENSDART00000124987 Essential Splice Site 596 4201 17 76

The following transcripts of ENSDARG00000040004 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 23433559)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 23362974
GRCz11 19 22947297
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAACTGGACACTGAGTCGGTGTACAATGTGACGTTCAACTCTAAAAGAGG[T/G]GAACTTAAAAAAAATAATAATAATTCCTAAATTTTCTGACAATACAACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29202
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050456 Nonsense 666 3895 19 70
ENSDART00000124987 Nonsense 745 4201 21 76

The following transcripts of ENSDARG00000040004 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 23438557)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 23367972
GRCz11 19 22952295
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACTAAATACTATACTTATTTAAATTCTAGCTCTGCTTGGCCTACAAAGGG[C/T]AGCTGAGAAATGAACTGGGAATATTGTTCAGTTATGAAACAGCAGATACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43278
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050456 Essential Splice Site 1783 3895 35 70
ENSDART00000124987 Essential Splice Site 1979 4201 39 76

The following transcripts of ENSDARG00000040004 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 23457932)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 23387347
GRCz11 19 22971670
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCAGTCTTTAAGTATGAGCTGCTGCTGACAGGGATAACGCCAAATGAGGG[T/C]AATTAAAAGCACTTCCTTGTTAATATAGATAGGATATGTCATATGTTATT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29203
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050456 Essential Splice Site 2198 3895 42 70
ENSDART00000124987 Essential Splice Site 2385 4201 46 76

The following transcripts of ENSDARG00000040004 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 23462073)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 23391488
GRCz11 19 22975811
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCAGAGTGGAATGATCAGATTCCAGCTTGTCCTGATGGATTTGACCCAG[G/T]TTTGGCTTTGCTTTTACTCATGTGTGAACAGATTTAACATAAATAAAATT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3041
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050456 Essential Splice Site 2244 3895 43 70
ENSDART00000124987 Essential Splice Site 2431 4201 47 76

The following transcripts of ENSDARG00000040004 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 23462334)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 23391749
GRCz11 19 22976072
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CACCACAACCAAACCAAAATCTGGCAATTGGCAGAATTGAATATGTCGAG[G/A]TAAATTGATATTCACTTCACGCTGATAAGCCTGTTATGCTTTATTMTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14852
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050456 Nonsense 2322 3895 44 70
ENSDART00000124987 Nonsense 2509 4201 48 76

The following transcripts of ENSDARG00000040004 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 23465296)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 23394711
GRCz11 19 22979034
KASP Assay ID:
1641-0483.1 (used for ordering genotyping assays)
KASP Sequence:
TGGGTGGAGCCTTCTTTATTGAGGATGRCATTGAAACTGGCAACATCCTA[C/T]ARTACAACCTGGCAGTGTTTGTAAAACAGAGCACCAGTTTACAAAATGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1501
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050456 Nonsense 2408 3895 44 70
ENSDART00000124987 Nonsense 2595 4201 48 76

The following transcripts of ENSDARG00000040004 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 23465556)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 23394971
GRCz11 19 22979294
KASP Assay ID:
554-1426.1 (used for ordering genotyping assays)
KASP Sequence:
GGACAGTTCTTCAACAATACAGTGCATTCGCAGGGTTGGTTTGGCTTGTG[G/A]ATTTTCCAAGATTTTTTCCCCATGGAGACCGGCAGCTGCAGCTACTCAAC
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

This allele has been removed from public view.

Allele Name:
sa636
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050456 Nonsense 2574 3895 44 70
ENSDART00000124987 Nonsense 2761 4201 48 76

The following transcripts of ENSDARG00000040004 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 23466052)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 23395467
GRCz11 19 22979790
KASP Assay ID:
554-0545.1 (used for ordering genotyping assays)
KASP Sequence:
TCAGTGGGATAAAGTTTTATCATTCACCAAACAAGGCCTGGCTCAGATGG[G/T]AACATGAAGTGGCGCTAGTAGACATTGATGGATCACTGACAGGTAAAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14766
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050456 None None 3895 None 70
ENSDART00000124987 Nonsense 2853 4201 50 76

The following transcripts of ENSDARG00000040004 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 23467103)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 23396518
GRCz11 19 22980841
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTAGGGTCATCAGTGCTACCGTTCCTTTATAMATTTATGACCCATTCATA[T/A]GGCTGGATGGCAATGCTCCCCACAGGCCAAACATACAACTGGTTATTTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23519
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050456 Nonsense 2953 3895 52 70
ENSDART00000124987 Nonsense 3244 4201 58 76

The following transcripts of ENSDARG00000040004 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 23471523)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 23400938
GRCz11 19 22985261
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGAAATGTGGCTTTACTGACCAGGAACATCCAGATCATTGGTCAGGAGTA[T/A]CCGGATATGTTCACAGAGTCTTATGGAGCTCGAGTTCTGGTGGGAACCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36835
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050456 Nonsense 2977 3895 53 70
ENSDART00000124987 Nonsense 3280 4201 59 76

The following transcripts of ENSDARG00000040004 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 23472077)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 23401492
GRCz11 19 22985815
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCATAACAGGGAAAGCTCAGATCAGAAATGTTCAGTTCTATCACACTGGA[C/T]AGGAGGGATGGAACGACCTGTCAGACCCACGATACTCTCTGGTGTTTCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43279
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050456 Nonsense 3334 3895 62 70
ENSDART00000124987 Nonsense 3640 4201 68 76

The following transcripts of ENSDARG00000040004 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 23476464)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 23405879
GRCz11 19 22990202
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTCATTTGTTATCAATTATTGGTTGTCTCGTATCAGCAAGGTGAACCCAT[C/A]GGACTGTGTGGACATGGACTGTGATGCTAAGAAGAAGACTATGTTGAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23520
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050456 Nonsense 3366 3895 62 70
ENSDART00000124987 Nonsense 3672 4201 68 76

The following transcripts of ENSDARG00000040004 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 23476559)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 23405974
GRCz11 19 22990297
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGAAAGACTTGGATGGCAGTTTCCTGGGAGCTGTGGGAGCAGTGGTTCCC[C/T]AGTCGGAGTATGAATGGAATGGAAACCCTCGGCATGGACTGGGTGACTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10779
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050456 Nonsense 3477 3895 64 70
ENSDART00000124987 Nonsense 3783 4201 70 76

The following transcripts of ENSDARG00000040004 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 23479498)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 23408913
GRCz11 19 22993236
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTACAGGCCCACAAGACYACAGCTGGTGCTCTGGCTACAYATGTCGGAAG[C/T]GAATTTCTCTCTTTCACGCCATTGTTGCCACAAACAAATCCTTTGAYAWC
Associated Phenotype:
Not determined