Busch Lab

ZMP

snrnp48

Ensembl ID:
ENSDARG00000039989
ZFIN ID:
ZDB-GENE-030131-4482
Description:
U11/U12 small nuclear ribonucleoprotein 48 kDa protein [Source:RefSeq peptide;Acc:NP_001108614]
Human Orthologue:
SNRNP48
Human Description:
small nuclear ribonucleoprotein 48kDa (U11/U12) [Source:HGNC Symbol;Acc:21368]
Mouse Orthologue:
Snrnp48
Mouse Description:
small nuclear ribonucleoprotein 48 (U11/U12) Gene [Source:MGI Symbol;Acc:MGI:1915047]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa25025 Nonsense Mutation detected in F1 DNA Not yet available
sa22904 Essential Splice Site Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa19146
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113834 Nonsense 56 338 2 9
Genomic Location (Zv9):
Chromosome 16 (position 38391419)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 37023947
GRCz11 16 36977831
KASP Assay ID:
2261-0072.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCATTTGTGTAATTTCTTTTATAATTTGATAGATGGAAGTCTGTCCATA[C/A]GATCCAAACCACACAGTTCCACAGAACAAGATGGAGAAACACAAAGCCGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25025
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113834 Nonsense 86 338 2 9
Genomic Location (Zv9):
Chromosome 16 (position 38391331)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 37023859
GRCz11 16 36977743
KASP Assay ID:
554-7731.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACACAAAGCCGTCTGTTGGCTCACACAGCAGGGATACTCTAAAGAAGAA[C/T]AGGTAAATAAAGGACCATATACTAAATGACTGCAAAATGTATTAATATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22904
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113834 Essential Splice Site 87 338 3 9
Genomic Location (Zv9):
Chromosome 16 (position 38391236)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 37023764
GRCz11 16 36977648
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATATATCTTGTAATAAAAATGTGGTGTTTGGTTTGTCCATTTCTTTTTTC[A/T]GGCTGAAATGTATGATCCATCAGCATACTATGAGCAAGCTAACATTACTT
Associated Phenotype:
Not determined