Busch Lab

ZMP

zgc:101072

Ensembl ID:
ENSDARG00000039974
ZFIN ID:
ZDB-GENE-040718-235
Description:
retinoic acid induced 14-like [Source:RefSeq peptide;Acc:NP_001104687]
Human Orthologue:
RAI14
Human Description:
retinoic acid induced 14 [Source:HGNC Symbol;Acc:14873]
Mouse Orthologue:
Rai14
Mouse Description:
retinoic acid induced 14 Gene [Source:MGI Symbol;Acc:MGI:1922896]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa31057 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa37278 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa31057
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058485 Essential Splice Site 56 988 3 18
ENSDART00000058487 Essential Splice Site 56 186 3 7
Genomic Location (Zv9):
Chromosome 21 (position 18398170)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 19533659
GRCz11 21 19570295
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCAAAAAAAGGAGCCTCTCCTACCAAACTTGACAGCGAGGGCAAGTCTGC[G/A]TAAGTATCAGGAACTGAAGCTGTTCTGTTTTCTATTTGATTTGCTCCTTT
Long Flanking Sequence:
TGAACTGCAGCAGATCGTCTTGATCATGTCCACATGCCTAAGTGCATTAAGTTACTGCCATGTGATTGGCTGATTAAAATTTGCATTAATTAGCAGTTGGACAGCTGTACCTAATAATAAGTGGCTGGTAAGTGTATCGTGATGCACCAATTACTGATTTCCCTTTTTTTTTTTTTTTTGGAAAAATATATAACAATTAAATATTATACATGAAAGTGTCAGAATGTCTCATTAATCTTTCTGTCTCCCTTTAATAACATGAGAATTAATTTGCAAGATTGTTTGCTTATGAACCATATTTTCTCTAGAGCTTTGGTTTATCAATGCACTATGTGTATGTTTCTGAATATATATTTTTCTTTTCTTCAGACCCATGAATGGAGCAAGAACGACGAGCGTCTCCTGAGTGCAGTGGAGCATGGAGAGGCAGATAAAGTCACCTCCCTCCTGTCAAAAAAAGGAGCCTCTCCTACCAAACTTGACAGCGAGGGCAAGTCTGC[G/A]TAAGTATCAGGAACTGAAGCTGTTCTGTTTTCTATTTGATTTGCTCCTTTACTGCCTTAATTGCCATTTCAGCCGTGTTTAGAGAGACTTTCTAGACTACATCTTCTGCAACCCACTTGAGATGTGCATAAAAATGAGTTTGTATGTGGGTGTTTACTCTCCAGCCGAGGGAGAGATTTGAGTCATGTGTTTTTTGTGTGCATCTGTTCATCAGGGTGTTTATTTAGGAGGAGAAATCATAATCTAAACCCCAGTCAAACAAATTTAGTCCTTCATTCAACCCTTCAGCCTTTCATATCATGTCATTTATTTTCTCTAATTTACTGCGTTATGCACACAGATGTTCAGATGCGAATGCTCGCCTTGTTTGTGCCAGTCATTCATCCAGCTTTAAAATATGCAACACACATTTTATCCAACAATAACCTAAAGCACTTAAAACCATGAAAAACTGAGATGAGAGCTCAGCATTTTTGGCTTTTTAAGTGTTTAACTTTGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37278
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058485 Essential Splice Site 314 988 12 18
ENSDART00000058487 None None 186 None 7
Genomic Location (Zv9):
Chromosome 21 (position 18427555)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 19563044
GRCz11 21 19599680
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACTCCACTTTCCAGCAACAGTGAATCATCCAAAAGATTTAACTACAAGG[T/G]AAAATACTGAAGGAGTGTTGAGAGATGGCAGTATGAAAGTAAAATACATA
Long Flanking Sequence:
AGACATGCACTGGCGTTTGTCTAACCCTGTAGTGATGATATCCTATTTACCCTAAACTTAAGTGTGCAGTGTGTATTTCACTAACCACTCAATCACTCTCTCCACTCTCCTCATCACGTGCACAATCTCAGCATGGTCAAAAGTTAAATGAGGACAGAAGCTCCACCCCCAAAAAGAGAAAAGCACCTCCTCCTCCCATTAGCCCAATGCAGGTAAAGGCACACAGTGCTGAATCTGTGATCTGCAATCATCTGTGTCTCCACTGTCTGTAAACCTTAGATGCAGTTACTTCATTAATGACTTCTGAAGATTCAGTTCATGGTTGTCTTTAATCTCTACCTATATTGGTTATGCTTGTCTCAACACTAAGCTTTGCTTTAATACTTTTCTCCGTGTATTTTTTTTTTAGTCGCCTGGTTTCACCTCACCACCTTATTTTACTCCTTCTGAAACTCCACTTTCCAGCAACAGTGAATCATCCAAAAGATTTAACTACAAGG[T/G]AAAATACTGAAGGAGTGTTGAGAGATGGCAGTATGAAAGTAAAATACATATGCATGCTAAAATGGAAGAAAACAATAGGTTTATTTTTATCATAATTTTATATTATAATAATATATTTAAGTTTATTTTAACCAATATTTTAAACAGTGAATAATACATTTAAAACATACAGTAAAGTACAAAAATGCAATAAATAAATAAATATATTAAACTAAATGCTAAATAAAAAGACTTCAGTTGCTATTTCCATAGTTTTGCAAACATACTGCACCTATGTGTGCAATTTACTATTAATGGAAGTACAATTCATTAATGCAATACTTACTGTTGAACTATTTATGTATAAATTATGGAAAATTGCATTTGTTTATTATTAGAGATTTTATACAATAATATTGCTTGTATTTGTTGTTCATTTGTTTATTGCATGTTTACTTTAATTATACTTTTGTATAGGCCTGTTATAACACAGCACATAGAGATTACCTTATTAATTTGTA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29564
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058485 Nonsense 540 988 15 18
ENSDART00000058487 None None 186 None 7
Genomic Location (Zv9):
Chromosome 21 (position 18430459)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 19565948
GRCz11 21 19602584
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCTGCAGAAGTTTCAGTATTTAAAGAGCTGCTTGGAGCAGGAGGTCAAA[G/T]AACTGAAGGCAAAGTTGATCAAGTCACAGGAAGTGCAGAAACGAGATTCT
Long Flanking Sequence:
AAGTGATTAACCAGATTTTCAAGAACATTTTTCTTTTTTCTGAGCAGAAACGTCCAGCTCCACAAGGAGAGGAAGGCCAGGGAAGTTCCCGTCCGAACAGCATTGATTCCAATGCCTCGTACCACTCCACCCGTGCCGATTTTGAGCTTTCCAGTGACACACAAATCCACACCGGTGACGAAGAGGATCTTTCTGTTCTGGACATCAGCGGATCCTCCATTAAACTAGAGATGGACGAGGATGTGAGGTTGAGTCAGGATAGAGAAATCGGACTTCTCCGAGATGCATTAGAGAACCTGCAGACCAAACTAATTGAGTCAAAAAGGGAGAATCGCTCCCTTCATGCAAGACTCGACACTAATTCTGAGAAAAGCCTGAGTGAAGATGGCCAAAAACCTCAAGAAGAGTTACAGCTGAGGGGAGAGTCTGCAGGTGCAGCGGAGGACAATGTGCTGCAGAAGTTTCAGTATTTAAAGAGCTGCTTGGAGCAGGAGGTCAAA[G/T]AACTGAAGGCAAAGTTGATCAAGTCACAGGAAGTGCAGAAACGAGATTCTTGTCTAATCAGAGATCTTCAGGCTCAGCTAAAAAATGGCCATCTCTCTGAAGAGGAGCGTCAAGAACTGAAGAACACCTACAGTGCTTTGGTAGAGAATGTCAACCAGGAGAAAACGCTGCTGATCGAGAAGTACAAGGAGTCCCAAGAGGAGATCAAAATGCTCCAGGAAGCTCTTTGTGGGACTGTGCCGGTGGAGGCTGCTGCCAAAGACTTTGAGGAGATGAAGGCAGAGCTCGGGGAGATTATCGACGGGCTCCAGCGGCGGCTTTTAGAGCTCTCAAAGTCATACAGTGAAGCCAAAAGCGAGCTTAGCGCTGCCCGCAACCAACTGCAGGCCAAAGCTTCAGAGTCTAAAGACAAAACAGACGTGGTTTGTGTCACTAAGGAGGAGCACGAGCAGAAAATTCAAGAGCTGGTCTTCAAAATGAAGGATATTCAGAATGTTCTG
Associated Phenotype:
Not determined