Busch Lab

ZMP

cnr2

Ensembl ID:
ENSDARG00000039970
ZFIN ID:
ZDB-GENE-040702-7
Description:
cannabinoid receptor 2 [Source:RefSeq peptide;Acc:NP_998129]
Human Orthologue:
CNR2
Human Description:
cannabinoid receptor 2 (macrophage) [Source:HGNC Symbol;Acc:2160]
Mouse Orthologue:
Cnr2
Mouse Description:
cannabinoid receptor 2 (macrophage) Gene [Source:MGI Symbol;Acc:MGI:104650]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa36197 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28697
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058473 Nonsense 36 383 2 2
Genomic Location (Zv9):
Chromosome 16 (position 35427622)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 33159931
GRCz11 16 33113961
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTAACCCCCCCACCCAATTTGTTACAGATAAAAGCTTATGCAATAGCCTA[C/T]AGTGCTACATGGTTTTGACCACACAAGAGCAGAAAGCTATCAGCTCAATT
Long Flanking Sequence:
ATGGTTTAACACAGGGGTGACACGGCTCAGTGGTTAGCGCTGTCACCTCAAGAAAGTCACTGGTTCGAGTTTGTTCTCCCAGTGTTTGCATGGGTTTCCGGAAAATTTATTAACCTCCGGCGCTTGTATGTATATGGATGTTGGTATAGGTGAATTTAATAAGCTAAATTGGCAGTGGTATATGTGTGAATGAATGTTATGGATGTTTCCCACTACTGGGTTGCAGCTGGAAGGGCATCCAATGCGTAAAACATATGCTGGATTAGTTGGTGGTTCATTCCGGTGTGGCAACTCCTGATGAATAAAGAGACTAAGCTGAAGGAAAATGAATGAATGAATGGTTCAACATTCAGTTGAAATTCTTTTATCTATTTTTCAATTAATTTATTTTTTCTATATTAAAAATGTACATTTCATATAACCTTTAAATGAATTGCATTTAAACAGGAAGTAACCCCCCCACCCAATTTGTTACAGATAAAAGCTTATGCAATAGCCTA[C/T]AGTGCTACATGGTTTTGACCACACAAGAGCAGAAAGCTATCAGCTCAATTTGCTTTCTAGCCGGCCCAGTGACTTTCCTGGCGAACATTTTGGTCCTGCTGACCATTGCAAGCTCCACAGCACTGCGCAGACGCCCATCGTACCTGTTTATCAGCAGCCTGGCACTGGCCGACATGTTTGCCAGCTGTTTCTTCACCATCAGTTTTCTAGATTTCCATCTTCTCAGTCAGAGAGACGATGCTAACCTCTATCTCTTCAAGCTTGGTGGCGTCACAATGGCGTTTACGGGCTCTGTGGGAAGCCTTTTGCTGACAGCGCTGGACCGATATCTTTGCATCTACCAGGCTTCCAATTACAAGCTGCTACTGACACGCACTAGAGCCAAACTGGCCATATTATTCTTATGGTGTGTGACGATTATTCTCTCATTCCTCCCTTTGATGGGGTGGAGGTGCAAAACCTGGTTGGATCGTCCATGCTCACGTCTCTTCCCGTACGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36197
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058473 Nonsense 244 383 2 2
Genomic Location (Zv9):
Chromosome 16 (position 35428247)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 33160556
GRCz11 16 33114586
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TATCCTGTGGAAAGCAAATCGCCATGAAGCAAATATGGGTGGACCAAAGT[T/A]AGGGAGGCAGAGCGTGAAAGGACAGGCTCGAATGCGAATGGACATTCAGC
Long Flanking Sequence:
GCGCAGACGCCCATCGTACCTGTTTATCAGCAGCCTGGCACTGGCCGACATGTTTGCCAGCTGTTTCTTCACCATCAGTTTTCTAGATTTCCATCTTCTCAGTCAGAGAGACGATGCTAACCTCTATCTCTTCAAGCTTGGTGGCGTCACAATGGCGTTTACGGGCTCTGTGGGAAGCCTTTTGCTGACAGCGCTGGACCGATATCTTTGCATCTACCAGGCTTCCAATTACAAGCTGCTACTGACACGCACTAGAGCCAAACTGGCCATATTATTCTTATGGTGTGTGACGATTATTCTCTCATTCCTCCCTTTGATGGGGTGGAGGTGCAAAACCTGGTTGGATCGTCCATGCTCACGTCTCTTCCCGTACGTGGATCGTCACTATTTGGCCAGCTGGACGGGTCTGCAGCTTGTGATGCTTTTTCTTATCATAGTGGCTTATGCTCTTATCCTGTGGAAAGCAAATCGCCATGAAGCAAATATGGGTGGACCAAAGT[T/A]AGGGAGGCAGAGCGTGAAAGGACAGGCTCGAATGCGAATGGACATTCAGCTCGCACACACTTTTAGTTTGATCCTTCTAATCCTGGCGATCTGTTGGCTGCCCGTCCTGTCCTTTATGGTAGTGGACGTCAGAGTGACCCTGACAAACAAACAACAGCGAATGTTCGCTTTCTGTAGCACACTGTGTCTGGTGAACTCTTGTGTAAACCCTCTTCTCTATGCCCTGCGCTGCCGAGAGCTGAGGGGAGAAATGCTGGCATTGATAGAATGTTGCAAGGCATGCAGGGAACATGCTTTGGGTCATACTCATGGCCAAATAACTGATAGCAGTTCTGGCAAAAAGAGCACAAATCCGGCAGTGAGTGGTAGTAACCCAGAAATTGTTTCTAGGAGTGCAGACAGGCAGCAAAACAGCATATGAATAATGTCTAAAAGTCATATTTACTTGTCATTTTGTTTATGGAAGCACAATATATTGTTGGCCACAACGATATCGGCCG
Associated Phenotype:
Not determined