Busch Lab

ZMP

rspo1

Ensembl ID:
ENSDARG00000039957
ZFIN ID:
ZDB-GENE-040718-44
Description:
R-spondin-1 [Source:UniProtKB/Swiss-Prot;Acc:Q6DHR0]
Human Orthologue:
RSPO1
Human Description:
R-spondin homolog (Xenopus laevis) [Source:HGNC Symbol;Acc:21679]
Mouse Orthologue:
Rspo1
Mouse Description:
R-spondin homolog (Xenopus laevis) Gene [Source:MGI Symbol;Acc:MGI:2183426]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa42772 Nonsense Mutation detected in F1 DNA Not yet available
sa12606 Essential Splice Site Available for shipment Available now
sa36198 Nonsense Mutation detected in F1 DNA Not yet available
sa16889 Nonsense Available for shipment Available now
sa16782 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa42772
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058459 Nonsense 3 261 2 6
Genomic Location (Zv9):
Chromosome 16 (position 36119673)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 33851982
GRCz11 16 33806012
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACAGCGTGAAAGGGGCGTCCTCAGTGACTGGGCACCAGGGACTATGCATT[T/A]GGGACTGCTGGCGCTGGCACTGGTCTTCTTCAGCTCCATGGGTCACGCCG
Long Flanking Sequence:
CGTGCTGACTTAACAAAGTACCATTCTATATACATGTCTCATTGTGCTTTTCTCCCCCCATTCACCCACTCCAACTCCCTCTTTCCCTCGCTCGCCCCTTTTCCTCTGTCTCTCGGCTGCAGATCTTGGCACTGACAGATGCGTTGTCACGCGTAGGAGTCCAGAACCTCTCTCCATCTCGTTTTTTTCAGCTCTCCCCCTCCTTCTCCTCCAAGCATCCCTAATAAGACATGCTCCTGGGCTGGGTTGCTCACTCACGGTAGGATCTCCCATACTCAATCGCCGCCAGCTCCTCTTCTCGGCTTCATGGGTTGAAGGGCGCACAAGATCTCCCAAAGGTGATCTTCTTCATCGCGCTATGGTTTGCTCTCTAAACATGTCCGGGCTTGCCAAAGGCTCCCCCAGCCAAAGGCTCCGCGAGCGGCTGTAGTCCACTTCGTTCCACCTGCCACAGCGTGAAAGGGGCGTCCTCAGTGACTGGGCACCAGGGACTATGCATT[T/A]GGGACTGCTGGCGCTGGCACTGGTCTTCTTCAGCTCCATGGGTCACGCCGATAACCTCAAGGCCTCCAAAGCAAGAAGACAGAGACGGAGTGAGTGCTGATGTTTCTTTTTTGACAACTTTTCTCTTTTAGGTGGCTGGGGTTTTACTGTTTCTTCAGACCTAATGCAGCTTTTCAATTGGTAGCCCCTATTATTTGTGGCTCATTAAGGGGCTTTTGACTTGCTTGGAATGTGCTTTTTGGGGTTTTTGTGCTTTTTGAAATGTGGGGTAGTGCAGCTTTTAATAGCAACTTTTCTTTTTAAGGCAAATTGGAAATGAGCATATCATGTTCTAAAGAGCAGCCAATTTCGAGCCATTAGATGATACTTAACTATAATGCCTAACACATTTTATTTTTGCTAATCTTTTGACTTCAAAACCTTTTTTACTTATTGTGTGCGTTTCTCATTACAGTAGAGCATTACTTTAAGAGAAGAGACACTGAAATCAAGTGTGTGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12606
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058459 Essential Splice Site 32 261 2 6
Genomic Location (Zv9):
Chromosome 16 (position 36119583)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 33851892
GRCz11 16 33805922
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGGTCACGCCGATAACCTCAAGGCCTCCAAAGCAAGAAGACAGAGACGGA[G/A]TGAGTGCTKATGTTTCTTTTTTGACAACTTTTCTCTTTTAGGTGGCTGGG
Long Flanking Sequence:
CTCGCCCCTTTTCCTCTGTCTCTCGGCTGCAGATCTTGGCACTGACAGATGCGTTGTCACGCGTAGGAGTCCAGAACCTCTCTCCATCTCGTTTTTTTCAGCTCTCCCCCTCCTTCTCCTCCAAGCATCCCTAATAAGACATGCTCCTGGGCTGGGTTGCTCACTCACGGTAGGATCTCCCATACTCAATCGCCGCCAGCTCCTCTTCTCGGCTTCATGGGTTGAAGGGCGCACAAGATCTCCCAAAGGTGATCTTCTTCATCGCGCTATGGTTTGCTCTCTAAACATGTCCGGGCTTGCCAAAGGCTCCCCCAGCCAAAGGCTCCGCGAGCGGCTGTAGTCCACTTCGTTCCACCTGCCACAGCGTGAAAGGGGCGTCCTCAGTGACTGGGCACCAGGGACTATGCATTTGGGACTGCTGGCGCTGGCACTGGTCTTCTTCAGCTCCATGGGTCACGCCGATAACCTCAAGGCCTCCAAAGCAAGAAGACAGAGACGGA[G/A]TGAGTGCTGATGTTTCTTTTTTGACAACTTTTCTCTTTTAGGTGGCTGGGGTTTTACTGTTTCTTCAGACCTAATGCAGCTTTTCAATTGGTAGCCCCTATTATTTGTGGCTCATTAAGGGGCTTTTGACTTGCTTGGAATGTGCTTTTTGGGGTTTTTGTGCTTTTTGAAATGTGGGGTAGTGCAGCTTTTAATAGCAACTTTTCTTTTTAAGGCAAATTGGAAATGAGCATATCATGTTCTAAAGAGCAGCCAATTTCGAGCCATTAGATGATACTTAACTATAATGCCTAACACATTTTATTTTTGCTAATCTTTTGACTTCAAAACCTTTTTTACTTATTGTGTGCGTTTCTCATTACAGTAGAGCATTACTTTAAGAGAAGAGACACTGAAATCAAGTGTGTGCTCGTGATCATCTCGTAGTAAGAGCAATAATTTAGGAAAAGTGCTTTTTTTTTGCGTGTGTGAACTCATGTTTTTACAAAGTGTTTTTTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36198
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058459 Nonsense 41 261 3 6
Genomic Location (Zv9):
Chromosome 16 (position 36110219)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 33842528
GRCz11 16 33796558
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTCATATCTGTCTTTTCTCCATCAGTAAGCACTGAAGTTCCTCCATCATG[T/A]TCGAATGGATGTGAACACTGCTCGGAGTACAACGGCTGTCTTAAATGTCG
Long Flanking Sequence:
ATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATATATCTATCTATCTATCTATCTAACTGTCTGTCTGTCTTTCTATCCATCCATCCATCCATCCATCCATCCATCCCACCCACCAATCCATCCATCCATCCATCCATCCATCCATCCATCCATCCATCCATCCATCCATCCATCCATCCATTTCATTTATCGGTCATTTATGCTGAGCACTGTATTTATGTCTGTCTGTCATGATGGTAAACTCAAAGTGAGGGCCACTTTGAGGGGTTGTTTGTTCAGTTTCTGACAGTTTGCACACTTAACATGCTTACTCCCAATTATTATATTTATTATTATCACTTTGGAATACAGATCGTCTTATAAGTTATAATGAAATGCTACCTGTACATTTACTAACTCATATCTGTCTTTTCTCCATCAGTAAGCACTGAAGTTCCTCCATCATG[T/A]TCGAATGGATGTGAACACTGCTCGGAGTACAACGGCTGTCTTAAATGTCGACCCCGACTCTTCATCTTACTGGAGCGAAATGATATCCGTCAGATAGGCATTTGCCTGGCCGCGTGTCCTGTTGGATATTATGGCATTCGAAATCGGGATATGAACAAATGCACACGTAAGTCTTTGCTCTAATTTCAAAACCATACATTTTTATGTATGTAATATACTGTAAGCTCTGCCAATCAGTGTATTTGAATGATTCTGTAGGATTATGTGACACTAAAGACTGCAGTAATGAATGCTGAAAATTCAGCTTTAACCTCACATGAAAAAATTATATTTGAAATATACATTAAGGTATAAATTCAGTAATTGTTACAGTTATTTTGCTATTTTTAACAGCACTTTTATTTAATTGTTTTATTAGAATACTCTGTGTAGATGTCTTATATGTGTATTCACAATATAAAACAAGTAAAAATAAAATAATTAGAGAAATATTAAAATAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16889
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058459 Nonsense 54 261 3 6
Genomic Location (Zv9):
Chromosome 16 (position 36110180)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 33842489
GRCz11 16 33796519
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCTCCATCATGTTCGAATGGATGTGAACACTGCTCGGAGTACAACGGCTG[T/A]CTTAAATGTCGACCCCGACTCTTCATCTTACTGGAGCGAAATRATATCCG
Long Flanking Sequence:
TATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATATATCTATCTATCTATCTATCTAACTGTCTGTCTGTCTTTCTATCCATCCATCCATCCATCCATCCATCCATCCCACCCACCAATCCATCCATCCATCCATCCATCCATCCATCCATCCATCCATCCATCCATCCATCCATCCATCCATTTCATTTATCGGTCATTTATGCTGAGCACTGTATTTATGTCTGTCTGTCATGATGGTAAACTCAAAGTGAGGGCCACTTTGAGGGGTTGTTTGTTCAGTTTCTGACAGTTTGCACACTTAACATGCTTACTCCCAATTATTATATTTATTATTATCACTTTGGAATACAGATCGTCTTATAAGTTATAATGAAATGCTACCTGTACATTTACTAACTCATATCTGTCTTTTCTCCATCAGTAAGCACTGAAGTTCCTCCATCATGTTCGAATGGATGTGAACACTGCTCGGAGTACAACGGCTG[T/A]CTTAAATGTCGACCCCGACTCTTCATCTTACTGGAGCGAAATGATATCCGTCAGATAGGCATTTGCCTGGCCGCGTGTCCTGTTGGATATTATGGCATTCGAAATCGGGATATGAACAAATGCACACGTAAGTCTTTGCTCTAATTTCAAAACCATACATTTTTATGTATGTAATATACTGTAAGCTCTGCCAATCAGTGTATTTGAATGATTCTGTAGGATTATGTGACACTAAAGACTGCAGTAATGAATGCTGAAAATTCAGCTTTAACCTCACATGAAAAAATTATATTTGAAATATACATTAAGGTATAAATTCAGTAATTGTTACAGTTATTTTGCTATTTTTAACAGCACTTTTATTTAATTGTTTTATTAGAATACTCTGTGTAGATGTCTTATATGTGTATTCACAATATAAAACAAGTAAAAATAAAATAATTAGAGAAATATTAAAATAGAGCACTATAATAGTATTTTACCATATTGCAGTCTATTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16782
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058459 Nonsense 85 261 3 6
Genomic Location (Zv9):
Chromosome 16 (position 36110087)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 33842396
GRCz11 16 33796426
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
RATATCCGTCAGATAGGCATTTGCCTGGCCGCGTGTCCTGTTGGATATTA[T/A]GGCATTCGAAAKCRGGATATGAACAAATGCACACGTAAGTCTTWGCTCTA
Long Flanking Sequence:
ATCCATCCATCCATCCATCCATCCATCCCACCCACCAATCCATCCATCCATCCATCCATCCATCCATCCATCCATCCATCCATCCATCCATCCATCCATCCATTTCATTTATCGGTCATTTATGCTGAGCACTGTATTTATGTCTGTCTGTCATGATGGTAAACTCAAAGTGAGGGCCACTTTGAGGGGTTGTTTGTTCAGTTTCTGACAGTTTGCACACTTAACATGCTTACTCCCAATTATTATATTTATTATTATCACTTTGGAATACAGATCGTCTTATAAGTTATAATGAAATGCTACCTGTACATTTACTAACTCATATCTGTCTTTTCTCCATCAGTAAGCACTGAAGTTCCTCCATCATGTTCGAATGGATGTGAACACTGCTCGGAGTACAACGGCTGTCTTAAATGTCGACCCCGACTCTTCATCTTACTGGAGCGAAATGATATCCGTCAGATAGGCATTTGCCTGGCCGCGTGTCCTGTTGGATATTA[T/A]GGCATTCGAAATCGGGATATGAACAAATGCACACGTAAGTCTTTGCTCTAATTTCAAAACCATACATTTTTATGTATGTAATATACTGTAAGCTCTGCCAATCAGTGTATTTGAATGATTCTGTAGGATTATGTGACACTAAAGACTGCAGTAATGAATGCTGAAAATTCAGCTTTAACCTCACATGAAAAAATTATATTTGAAATATACATTAAGGTATAAATTCAGTAATTGTTACAGTTATTTTGCTATTTTTAACAGCACTTTTATTTAATTGTTTTATTAGAATACTCTGTGTAGATGTCTTATATGTGTATTCACAATATAAAACAAGTAAAAATAAAATAATTAGAGAAATATTAAAATAGAGCACTATAATAGTATTTTACCATATTGCAGTCTATTTTATATAGCATATGTAGATGTATTCAGATCTCTAGCTACATATATACACTCACCGGCCATTTTATTGGGTACACCTTACTAGCACAAGGTTGGAC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4672
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058459 Nonsense 125 261 4 6
Genomic Location (Zv9):
Chromosome 16 (position 36104220)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 33836529
GRCz11 16 33790559
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCCGAAACTTTTGCACAAAATGTAAGGAAGGCCTGTACTCGCWTAGAGGG[C/T]GATGTTTCTCCAGCTGTCCTGAAGGATTCACCGTCAACGGCACCATGGAG
Long Flanking Sequence:
GGTTGACATGATTTTCAGATTTTAGAACAGCAAGCTCAGACTTCTGGACCCCACTTTAAATCATTTCTGATTTTTCTTTAGTAAAGAAAGAGACTAAGATGGATATTTAAGAGGAGCATCCACTGTTTATCAGAATGAGATAATGAATATAATAGCGTTATGGGCTGGGAAGTGTATTCAGTTTGGTTTTGTATTTGTCTGGTTTTCATTCTGAAGGAATCCACATTGCCCCCAAATTGATGTAGACAGAACACTTGTAACAAGACAGAGATGTGAGGTGTGACATCTTTGACTACTTTTGGATTAGAATCTGTCAATGCTAGAAAAAAAATGGTCACTGAATGGTGGTCCGCTTGTTCTACTTTGAAATGTGTATTGATAAAACAACTATAGCACTGTCTTTTTTCTTTATTTCAGAATGTAAAATAGAAAACTGTGAGGCATGTTTTAGCCGAAACTTTTGCACAAAATGTAAGGAAGGCCTGTACTCGCATAGAGGG[C/T]GATGTTTCTCCAGCTGTCCTGAAGGATTCACCGTCAACGGCACCATGGAGTGTGTAGGTGAGTCTCCTACAGCCTTTTGCTGTCATTGAGAGAGTCACTATTATTTCCTTAGTGTTTTTACAATGTAGATTATGTCAATACCAGTATTTCAGATTATTAAACATATATTCAGCATATCAGGCAGCAGAGTAGTCGTAGTTGTCAAGGAAGCGCTTTTTATTTTCATGTTAGTTAAAGGAACACTTTTTTTAAATAGGCTTATCTTACTAGAGTTGAACAGTTCAGTTTCACCAGTTTAAATCCATTTAGATGATCTCCGGGTCTGGCGGGAGTATAAATTATTGCATAAATTATTAATTTATAGCATAAATTATTGAATCGGATTAGACCATTAGCATTTATTTAAAAAAAAAGTAAAAAAAAAAAAAAAAAAAAAAGTTTTGATAATTTTTCTGTTTAAGGTTTGACTATTCTGTTGTTATATCATGTACTAAGCCTGA
Associated Phenotype:
Not determined