Busch Lab

ZMP

fam46ba

Ensembl ID:
ENSDARG00000039943
ZFIN ID:
ZDB-GENE-061110-129
Description:
hypothetical protein LOC777768 [Source:RefSeq peptide;Acc:NP_001071274]
Human Orthologue:
FAM46B
Human Description:
family with sequence similarity 46, member B [Source:HGNC Symbol;Acc:28273]
Mouse Orthologue:
Fam46b
Mouse Description:
family with sequence similarity 46, member B Gene [Source:MGI Symbol;Acc:MGI:2140500]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa8575 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28699
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058424 Nonsense 252 393 2 2
Genomic Location (Zv9):
Chromosome 16 (position 36471371)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 34099992
GRCz11 16 34054022
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGAAGAAATTCGCGGAGGCGGCCTCTTAAAATACTGCCACCTTTTAGTG[C/T]GAGGATTCCGTCCCACTTCCGAATCGGAGATGAAATCGCTCCAGCGGTAC
Long Flanking Sequence:
TCGGATACAAAGACTTGGACCTGATTTTTGGTGTTTCTCTGTCAGATGACCAGGCTTTCCGTGTGGTGAAGGACGTGGTTCTCGACAGCCTGCTGGACTTCCTACCTGAAGGCGTCAGCAAAGAGCGAATCTCAGCACTGACTCTGAAAGAGGCTTACGTGCAGAAACTGGTGAAGGTGTGCAACGACACCGACCGCTGGAGCCTCATCTCGCTTTCCAATAACACAGGCAAGAACGTCGAGCTCAAGTTCGTGGACTCTCTAAGACGGCAGTTTGAGTTCAGCGTGGACTCCTTCCAGATTGTTTTGGACTCTCTTCTTCTGTTCGACCGTTGTTCGGAGACGCCCATGTCGGAGTGTTTCCACCCTACAGTTTTGGGCGAGAGTATGTATGGGAACTTCGAGGAAGCTCTTGGCCATCTGTGCAACAAGGCCATCGCTACACGAAACCCTGAAGAAATTCGCGGAGGCGGCCTCTTAAAATACTGCCACCTTTTAGTG[C/T]GAGGATTCCGTCCCACTTCCGAATCGGAGATGAAATCGCTCCAGCGGTACATGTGCTCTCGGTTCTTCATTGACTTTCCAGACATCGGGGAGCAGCAGCGAAAACTGGAGGCGTACCTACAGAATCACTTTGCCGGAATGGAGCACAAACGGTATGACTGTTTGGTCACGTTGTACCACGTGGTCAATGAGAGTACTGTATGCTTAATGGGACACGAGCGACGGCAGACTTTAAACCTTATCTCAATGCTGGCGCTAAGGGTGCTCGCCGAACAGAACGCCATCCCTACAGTTACCAACGTCACATGTTATTACCAGCCGGCACCGTACGTGCGAGACATCAACTTCAGTAACTACTACATTGCTCACGTGCAGCCGCTGGTTCACACTTGCAGTAGTTCCTATCCGACATGGCTGCCCTGTAACTGACACAGTCGACATCCGTTCTCGTACATCCCCATGTGCTGGAGATGATATGCAAGCAAGTGAATATAAAACGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8575
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058424 Nonsense 283 393 2 2
Genomic Location (Zv9):
Chromosome 16 (position 36471464)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 34100085
GRCz11 16 34054115
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGCGGTACATGTGCTCTCGGTTCTTCATTGACTTTCCAGACATCGGGGAG[C/T]AGCAGCGAAAACTRGAGGCGTACCTRCAGAATCACTTTGCCGGAATGGAR
Long Flanking Sequence:
TGGACTTCCTACCTGAAGGCGTCAGCAAAGAGCGAATCTCAGCACTGACTCTGAAAGAGGCTTACGTGCAGAAACTGGTGAAGGTGTGCAACGACACCGACCGCTGGAGCCTCATCTCGCTTTCCAATAACACAGGCAAGAACGTCGAGCTCAAGTTCGTGGACTCTCTAAGACGGCAGTTTGAGTTCAGCGTGGACTCCTTCCAGATTGTTTTGGACTCTCTTCTTCTGTTCGACCGTTGTTCGGAGACGCCCATGTCGGAGTGTTTCCACCCTACAGTTTTGGGCGAGAGTATGTATGGGAACTTCGAGGAAGCTCTTGGCCATCTGTGCAACAAGGCCATCGCTACACGAAACCCTGAAGAAATTCGCGGAGGCGGCCTCTTAAAATACTGCCACCTTTTAGTGCGAGGATTCCGTCCCACTTCCGAATCGGAGATGAAATCGCTCCAGCGGTACATGTGCTCTCGGTTCTTCATTGACTTTCCAGACATCGGGGAG[C/T]AGCAGCGAAAACTGGAGGCGTACCTACAGAATCACTTTGCCGGAATGGAGCACAAACGGTATGACTGTTTGGTCACGTTGTACCACGTGGTCAATGAGAGTACTGTATGCTTAATGGGACACGAGCGACGGCAGACTTTAAACCTTATCTCAATGCTGGCGCTAAGGGTGCTCGCCGAACAGAACGCCATCCCTACAGTTACCAACGTCACATGTTATTACCAGCCGGCACCGTACGTGCGAGACATCAACTTCAGTAACTACTACATTGCTCACGTGCAGCCGCTGGTTCACACTTGCAGTAGTTCCTATCCGACATGGCTGCCCTGTAACTGACACAGTCGACATCCGTTCTCGTACATCCCCATGTGCTGGAGATGATATGCAAGCAAGTGAATATAAAACGTTTTTTCCAAACTCAAAAAAAGGGATTTTCTGGAGGAGCTTTTATTTTTTTAAACAATGTCAATAGAGCATTCTTGGGACAGCGTCAAAATTGGG
Associated Phenotype:
Not determined